ELN - User contributions [en]

2478 pEC2-betaActin

2016-09-22T19:40:51Z

Excellgen:

== '''Cloning of 2478 pEC2-betaActin''' ==

PCR

[[File:BetaActin PCR.JPG|141x297px|BetaActin PCR.JPG]]

Digest with Nde1 and Xho1, clone into Nde1 and Xho1 digested pEC2. 

[[Category:Cloning]]

File:BetaActin PCR.JPG

2016-09-22T19:39:02Z

Excellgen:

2477 pEC2-ALB

2016-09-22T19:36:40Z

Excellgen:

== '''Cloning of 2477 pEC2-ALB''' ==

PCR

[[File:ALB PCR.JPG|RTENOTITLE]]

Digest with Nde1 and Xho1, clone into Nde1 and Xho1 digested pEC2.

[[Category:Cloning]]

File:PEC2 digestion(xho1&nde1)1.JPG

2016-09-22T19:34:40Z

Excellgen: Excellgen uploaded a new version of File:PEC2 digestion(xho1&nde1)1.JPG

File:ALB PCR.JPG

2016-09-22T19:29:56Z

Excellgen: Excellgen uploaded a new version of File:ALB PCR.JPG

2476 pEC2-TREC

2016-09-22T19:04:49Z

Excellgen:

== '''Cloning of 2476 pEC2-TREC''' ==

PCR using blood genomic DNA as template

[[File:Trec PCR 1.JPG|RTENOTITLE]]

Digest with EcoR1 and Xho1, clone into EcoR1 and Xho1 digested pEC2.

[[File:PEC2 digestion 1.JPG|210x275px|PEC2 digestion 1.JPG]]

=== '''Colony Screening''' ===

PCR screening

[[File:Trec PCR screening 2.JPG|RTENOTITLE]]

{| style="width: 226px" border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 88px; text-align: center" | Band1 
| style="width: 89px; text-align: center" | Band2 
| style="width: 61px; text-align: center" | Band13-18 
|-
| style="width: 88px; text-align: center" | No Template 
| style="width: 89px; text-align: center" | Primer 
| style="width: 61px; text-align: center" | 2476 
|}

Make miniprep and digest with EcoR1 and Xho1.

[[File:Trec digestion .JPG|RTENOTITLE]]
[[Category:Cloning]]

File:Trec digestion .JPG

2016-09-22T19:00:34Z

Excellgen:

File:Trec PCR screening 2.JPG

2016-09-22T18:59:57Z

Excellgen:

File:Trec PCR screening 1.JPG

2016-09-22T18:58:23Z

Excellgen: Excellgen uploaded a new version of File:Trec PCR screening 1.JPG

File:Trec digestion 1.JPG

2016-09-21T15:35:11Z

Excellgen:

File:Trec digestion.JPG

2016-09-21T15:33:43Z

Excellgen:

File:Trec PCR 1.JPG

2016-09-21T15:30:20Z

Excellgen:

File:Trec PCR.JPG

2016-09-21T15:28:47Z

Excellgen: Excellgen uploaded a new version of File:Trec PCR.JPG

File:PEC2 digestion 1.JPG

2016-09-21T15:25:39Z

Excellgen: Excellgen uploaded a new version of File:PEC2 digestion 1.JPG

File:IMG 1657.JPG

2016-09-21T15:19:22Z

Excellgen:

File:PEC2 digestion(xho1&EcoR1) .JPG

2016-09-21T15:15:30Z

Excellgen:

File:PEC2 digestion(xho1&EcoR1) (1).JPG

2016-09-21T15:13:24Z

Excellgen:

File:PEC2 digestion.JPG

2016-09-09T15:48:18Z

Excellgen:

PCR buffer development

2016-08-29T21:54:42Z

Excellgen:

[[File:IMG 1516.JPG|RTENOTITLE]]

{| style="width: 321px" border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 48px" | Lane 1 
| colspan="1" rowspan="4" style="width: 65px" | No glycerol 
| style="width: 193px" | Control:2X Taq Master Mix, Novoprotein 
|-
| style="width: 48px" | Lane 2 
| style="width: 193px" | Lot:67-2038+Bromophenol Blue 
|-
| style="width: 48px" | Lane 3 
| style="width: 193px" | Lot:2324+Bromophenol Blue 
|-
| style="width: 48px" | Lane 4 
| style="width: 193px" | Lot:100-2038+Bromophenol Blue 
|-
| style="width: 48px" | Lane 5 
| colspan="1" rowspan="4" style="width: 65px" | With glycerol 
| style="width: 193px" | Control:2X Taq Master Mix, Novoprotein 
|-
| style="width: 48px" | Lane 6 
| style="width: 193px" | Lot:67-2038+Bromophenol Blue 
|-
| style="width: 48px" | Lane 7 
| style="width: 193px" | Lot:2324+Bromophenol Blue 
|-
| style="width: 48px" | Lane 8 
| style="width: 193px" | Lot:100-2038+Bromophenol Blue 
|}

'''Corn genomic DNA as template, 2X Taq Master Mix, Novoprotein''' '''[[File:Corn genomic DNA.JPG|RTENOTITLE]]'''

{| style="width: 157px" border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 40px" | Lane 1 
| style="width: 106px" | 1 kb ladder 
|-
| style="width: 40px" | Lane 2 
| style="width: 106px" | 1 ul genomic DNA 
|-
| style="width: 40px" | Lane 3 
| style="width: 106px" | 2 ul genomic DNA 
|-
| style="width: 40px" | Lane 4 
| style="width: 106px" | 3 ul genomic DNA 
|-
| style="width: 40px" | Lane 5 
| style="width: 106px" | 4 ul genomic DNA 
|}

'''2016/08/26, Corn Genomic DNA as template'''

[[File:IMG 1550.JPG|RTENOTITLE]]

{| style="width: 263px" border="1" cellpadding="1" cellspacing="1"
|-
| 1 
| style="width: 233px" | Lot:67-2038 
|-
| 2 
| style="width: 233px" | Lot:2324 
|-
| 3 
| style="width: 233px" | Lot:100-2038 
|-
| 4 
| style="width: 233px" | Control:2X Taq Master Mix, Novoprotein 
|}

'''2016/08/29, Corn genomic DNA as template'''

'''[[File:2X PCR mix with dye.JPG|353x668px]]'''

{| border="1" cellpadding="1" cellspacing="1" height="53" width="316"
|-
| 1 
| 2X Taq Master Mix, Novoprotein 
|-
| 2 
| 2X PCR buffer with Bromophenol Blue and glycerol 
|}
[[Category:QC]]

File:2X PCR mix with dye.JPG

2016-08-29T21:51:54Z

Excellgen:

File:IMG 1556.JPG

2016-08-29T21:49:39Z

Excellgen:

File:IMG 1550.JPG

2016-08-26T21:00:14Z

Excellgen:

2016/08/25 Miniprep Column Comparison

2016-08-25T22:00:42Z

Excellgen:

{| style="width: 470px" border="1" cellpadding="1" cellspacing="1"
|-
| 
| 1 
| 2 
| 3 
| 4 
| 5 
| 6 
| 7 
| 8 
| 9 
| style="width: 41px" | 10 
|-
|
Column Type

| Qiagen 
| Qiagen 
| Omega 
| Omega 
| Hangzhou#1 
| Hangzhou#1 
| Hangzhou#2 
| Hangzhou#2 
| Hangzhou#3 
| style="width: 41px" | Hangzhou#3 
|-
| OD260 
| 235.8ng/ul 
| 243.8ng/ul 
| 292.8ng/ul 
| 269.8ng/ul 
| 199.5ng/ul 
| 237.4ng/ul 
| 251.7ng/ul 
| 271.0ng/ul 
| 226.6ng/ul 
| style="width: 41px" | 228.1ng/ul 
|-
| OD260/OD280 
| 1.93 
| 1.89 
| 1.93 
| 1.93 
| 1.91 
| 1.86 
| 1.91 
| 1.92 
| 1.91 
| style="width: 41px" | 1.90 
|}

[[File:IMG 1547.JPG]]

[[Category:QC]]

File:IMG 1547.JPG

2016-08-25T21:59:19Z

Excellgen:

File:Kit comparison.JPG

2016-08-24T21:12:50Z

Excellgen: Excellgen uploaded a new version of File:Kit comparison.JPG

File:IMG 1539.JPG

2016-08-24T18:10:24Z

Excellgen: Excellgen uploaded a new version of File:IMG 1539.JPG

2016/08/24 Miniprep column comparison

2016-08-24T18:08:36Z

Excellgen:

{| align="left" border="1" cellpadding="1" cellspacing="1" width="655"
|-
| colspan="2" style="width: 41px; text-align: center" | 
| colspan="5" rowspan="1" style="width: 44px; text-align: center" | Column from Omega 
| colspan="5" rowspan="1" style="width: 44px; text-align: center" | Column from Hangzhou 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | 
| style="width: 44px; text-align: center" | 1 
| style="width: 40px; text-align: center" | 2 
| style="width: 45px; text-align: center" | 3 
| style="width: 42px; text-align: center" | 4 
| style="width: 43px; text-align: center" | 5 
| style="width: 44px; text-align: center" | 6 
| style="width: 42px; text-align: center" | 7 
| style="width: 42px; text-align: center" | 8 
| style="width: 43px; text-align: center" | 9 
| style="width: 38px; text-align: center" | 10 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | Resuspension buffer 
| style="width: 44px; text-align: center" | P1 
| style="width: 40px; text-align: center" | P1 
| style="width: 45px; text-align: center" | P1 
| style="width: 42px; text-align: center" | P1 
| style="width: 43px; text-align: center" | P1 
| style="width: 44px; text-align: center" | P1 
| style="width: 42px; text-align: center" | P1 
| style="width: 42px; text-align: center" | P1 
| style="width: 43px; text-align: center" | P1 
| style="width: 38px; text-align: center" | P1 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | Lysis buffer 
| style="width: 44px; text-align: center" | P2 
| style="width: 40px; text-align: center" | P2 
| style="width: 45px; text-align: center" | P2 
| style="width: 42px; text-align: center" | P2 
| style="width: 43px; text-align: center" | P2 
| style="width: 44px; text-align: center" | P2 
| style="width: 42px; text-align: center" | P2 
| style="width: 42px; text-align: center" | P2 
| style="width: 43px; text-align: center" | P2 
| style="width: 38px; text-align: center" | P2 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | Neutralization buffer 
| style="width: 44px; text-align: center" | N3 
| style="width: 40px; text-align: center" | P3 
| style="width: 45px; text-align: center" | N3 
| style="width: 42px; text-align: center" | P3 
| style="width: 43px; text-align: center" | P3 
| style="width: 44px; text-align: center" | N3 
| style="width: 42px; text-align: center" | P3 
| style="width: 42px; text-align: center" | N3 
| style="width: 43px; text-align: center" | P3 
| style="width: 38px; text-align: center" | P3 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | Wash buffer1 
| style="width: 44px; text-align: center" | HBC 
| style="width: 40px; text-align: center" | HBC 
| style="width: 45px; text-align: center" | PB 
| style="width: 42px; text-align: center" | PB 
| style="width: 43px; text-align: center" | HBC 
| style="width: 44px; text-align: center" | HBC 
| style="width: 42px; text-align: center" | HBC 
| style="width: 42px; text-align: center" | PB 
| style="width: 43px; text-align: center" | PB 
| style="width: 38px; text-align: center" | HBC 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | Wash buffer2 
| style="width: 44px; text-align: center" | Wash 
| style="width: 40px; text-align: center" | Wash 
| style="width: 45px; text-align: center" | Wash 
| style="width: 42px; text-align: center" | Wash 
| style="width: 43px; text-align: center" | PE 
| style="width: 44px; text-align: center" | Wash 
| style="width: 42px; text-align: center" | Wash 
| style="width: 42px; text-align: center" | Wash 
| style="width: 43px; text-align: center" | Wash 
| style="width: 38px; text-align: center" | PE 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | Elution buffer 
| style="width: 44px; text-align: center" | EB 
| style="width: 40px; text-align: center" | EB 
| style="width: 45px; text-align: center" | EB 
| style="width: 42px; text-align: center" | EB 
| style="width: 43px; text-align: center" | EB 
| style="width: 44px; text-align: center" | EB 
| style="width: 42px; text-align: center" | EB 
| style="width: 42px; text-align: center" | EB 
| style="width: 43px; text-align: center" | EB 
| style="width: 38px; text-align: center" | EB 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | OD 260 
| style="width: 44px; text-align: center" | 40.3ng/ul 
| style="width: 40px; text-align: center" | 40.7ng/ul 
| style="width: 45px; text-align: center" | 32.8ng/ul 
| style="width: 42px; text-align: center" | 39.2ng/ul 
| style="width: 43px; text-align: center" | 43.3ng/ul 
| style="width: 44px; text-align: center" | 26.0ng/ul 
| style="width: 42px; text-align: center" | 57.0ng/ul 
| style="width: 42px; text-align: center" | 40.0ng/ul 
| style="width: 43px; text-align: center" | 47.5ng/ul 
| style="width: 38px; text-align: center" | 50.6ng/ul 
|-
| colspan="2" rowspan="1" style="width: 41px; text-align: center" | OD260/OD280 
| style="width: 44px; text-align: center" | 1.86 
| style="width: 40px; text-align: center" | 1.93 
| style="width: 45px; text-align: center" | 1.81 
| style="width: 42px; text-align: center" | 1.93 
| style="width: 43px; text-align: center" | 1.90 
| style="width: 44px; text-align: center" | 1.85 
| style="width: 42px; text-align: center" | 1.91 
| style="width: 42px; text-align: center" | 1.89 
| style="width: 43px; text-align: center" | 1.91 
| style="width: 38px; text-align: center" | 1.80 
|}

P3: Solution 3 from Omega

HBC: HBC buffer from Omega

Wash: DNA wash buffer from Omega

[[File:Miniprep comparison.JPG|RTENOTITLE]]
[[Category:QC]]

Genomic DNA from Plants

2016-08-24T18:07:29Z

Excellgen:

'''Extraction Buffer A (EBA) Per 100 mL'''

{| style="width:500px" border="1" cellpadding="1" cellspacing="1"
|-
| 2% (w/v) hexadecyltrimethylammonium bromide (CTAB) 
| 2.0 g 
|-
| 100 mM Tris (pH 8.0), Use 1 M stock 
| 10 mL  
|-
| 20 mM EDTA (Use 0.5 M stock)  
| 1 mL  
|-
| 1.4 M NaCl 
| 8.2 g  
|-
| 4% (w/v) polyvinylpyrrolidone (PVP) mw:~4000 
| 4.0 g 
|-
| 0.1% (w/v) ascorbic acid , optional 
| 0.1 g 
|-
| 10 mM β-mercaptoethanol (BME)* (Use 14.3 M stock) 
| 70 µL 
|}

''' Extraction Buffer B (EBB) Per 100 mL '''

{| style="width:500px" border="1" cellpadding="1" cellspacing="1"
|-
| 50 mM EDTA (Use 0.5 M stock) 
| 2.5 mL  
|-
| 100 mM NaCl 
| 0.6 g 
|-
| 10 mM β-mercaptoethanol (BME)* (Use 14.3 M stock) 
| 70 µL 
|}

''' 10 mM Tris (pH 8.0) (Use 1 M stock)'''

{| style="width:500px" border="1" cellpadding="1" cellspacing="1"
|-
| 1.0 mL TE Buffer Per 
| 100 mL  
|-
| 1 mM EDTA (Use 0.5 M stock) 
| 50 µl 
|}

'''Other Required Reagents''' 5 M potassium acetate (Stored at –20oC) 3 M sodium acetate (pH 5.2) 70% ethanol (stored at -20oC) Absolute isopropanol (stored at -20oC)

'''1 M Tris pH 8.0'''

Dissolve 121.1 g of Tris base in 800 ml of H2O. Adjust pH to 8.0 by adding 42 ml of concentrated HCL.

'''Binding Buffer:''' (2 M Guanidinhydrochloride, 75 % (v/v) Ethanol)

or   24 g guanidinium thiocyanate GuSCN, 20 mL 0.1 M Tris-HCl, pH 6.4,,Heat to 60°C to dissolve the GuSCN., Add 4.4 mL 0.2 M EDTA, pH 8.0. Mix by inverting.

'''Column Washing Buffer I: '''(10 mM NaCl, 10 mM Tris-HCl pH 6.5, 80 % (v/v) Ethanol).

'''Column Washing Buffer II: '''(96 % Ethanol). 

'''Elution Buffer: '''

'''Extraction Protocol: precipitation using isopropanol''' 1. Weight out 0.3 g of plant tissue 2. Place tissue on a clean glass slide. Chop the tissue into a paste using a clean single edge razor blade. (we have also modified a Dremel Roto-tool for use as a simple tissue homogenizer with good success) 3. Immediately transfer tissue to a 1.5 mL microcentrifuge tube (use Kontes #749520-0090) and (optional) further grind tissue with a tube pestle (Kontes #749521-1590) 4. Once the sample is prepared add 400 µL EBA, <s>900µl EBB,</s>  and  100 µl SDS. 5. Vortex and incubate at 65o C for 30 min. 6. Place tube on ice and add 400 µL cold 5 M potassium acetate. Mix by inversion and place tube back on ice for 3 min. 7. Centrifuge at 13,200 rpm for 10 min. (If possible, use a refrigerated microcentrifuge set to 4oC) 8. Transfer  supernatant to a new 1.5 mL microcentrifuge tube, add 5 ul RNase A, incubate at 37 oC for 30 min, then add 500 µL of ice cold absolute isopropanol, and incubate in ice for 20 min. 9. Centrifuge at 10,200 rpm for 10 min. discard the supernatant. Wash the pellet once in 250 µL 90% ethanol and let dry 10. Resuspend the dry pellet in 50 µL of TE.

QC DNA by nanodrop

'''Extraction Protocol: purification using a spin colum'''

4. Once the sample is prepared add 400 µL EBA and  100 µl SDS. 5. Vortex and incubate at 65o C for 30 min.

6. Place tube on ice and add 400 µL cold 5 M potassium acetate. Mix by inversion and place tube back on ice for 3 min. 7. Centrifuge at 13,200 rpm for 10 min. (If possible, use a refrigerated microcentrifuge set to 4oC)

6. Transfer supernatant to another tube, add 5 ul RNase A, incubate at 37 oC for 30 min

7. Cool on ice and add 500 µL cold Binding Buffer. Mix by inversion and place tube back on ice for 3 min. 8. Load to a spin column. Spin

9. Wash column with </span250 ul '''Column '''Washing Buffer I, spin

'''10. '''Wash column with 250 ul '''Column '''Washing Buffer II, spin,

'''11.  '''Elute DNA with 50 ul Elution Buffer preheated to 65 oC''.''

''[[File:Genomic DNA extraction.jpg|RTENOTITLE]]''

'''1:precipitation using isopropanol'''

'''2:purification using a spin colum'''

''''''

== Protocol for NGS ==

=== Materials and methods ===

Consumables 50 mL Falcon Tubes

RNAse A (Sigma Cat No. R6513)

Polyvinylpyrrolidone (PVP) (Sigma Cat No. PVP10) (not required)

Chloroform: Isoamyl alcohol 24:1 (Sigma Cat No. C0549)

Liquid nitrogen

β-mercaptoethanol (Sigma Cat No. 63689)

Trizma base (Sigma Cat No. 1503)

Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) (Chem Supply Cat No. EA023)

Agarose (Amresco Cat No. 0710)

Sodium Chloride (NaCl) (Ajax Finechem Cat No. 1103414)

Hexadecyltrimethylammonium bromide (CTAB) (Sigma Cat No. 52365)

Eco RI (not required- used for quality assurance) (NEB Cat No. R0101S)

Hin dIII-HF (not required- used for quality assurance) (NEB Cat No. R3104S)

=== Reagents ===

Extraction Buffer: 100 mM Tris-HCl (pH 7.5), 25 mM EDTA, 1.5 M NaCl, 2% (w/v) CTAB, and 0.3% (v/v) β-mercaptoethanol- added immediately before use

RNAse A stock solution (10 mg/mL)

5 M NaCl

95% ethanol (v/v)

70% ethanol (v/v)

TE Buffer: 10 mM Tris-HCl (pH 7.6), 0.1 mM EDTA

CutSmart Buffer (NEB Cat No. B7204S)

NEBuffer EcoRI (NEB Cat No. B0101S)

=== Equipment ===

Mortar and Pestle

Water Baths (65°C and 37°C)

Centrifuge (capable of spinning 50 mL centrifuge tubes at 5000 × g) 20°C Freezer Gel electrophoresis system (e.g. Jordan Scientific JP-250)

NanoDrop UV/Vis Spectrophotometer (e.g. NanoDrop 8000, Thermo Scientific)

=== Plant material and tissue collection ===

 Leaf tissue of Corymbia citriodora subsp. variegata, Corymbia henryi, Corymbia torelliana, and Corymbia citriodora subsp. citriodora was obtained from Queensland Department of Agriculture, Fisheries and Forestry in Gympie, Australia. Leaf tissue of Coffea brassii was obtained from the Australian Tropical Herbarium in Cairns, Australia. Leaf material after harvesting was transported on ice and stored at -80°C until subjected to DNA extraction.

=== Protocol ===

 '''Preparatory steps''' Before grinding, pre-chill the mortar and pestle (to minimize frozen tissue thawing) and 95% ethanol solution at -20°C. Pre-heat water baths (65°C and 37°C) before beginning the extraction. Once pre-heated, prepare 10 mL (per 1 g of leaf tissue) extraction buffer by adding 0.3% (v/v) β-mercaptoethanol in a 50 mL Falcon tube, and pre-heat in the 65°C water bath. PVP can also be added at this point, but is not required.

'''Grinding and tissue disruption''' Using liquid nitrogen, grind 1 g of frozen leaf tissue into a fine powder. Place the powder into a new 50 mL Falcon tube and mix in the pre-heated extraction buffer. Put the sample into the 65°C water bath and mix by inversion every 10 min for 30 min- 1 h. After incubation, centrifuge the sample tube for 5 min at 5000 × g (to pellet and remove un-lysed leaf tissue) and decant the supernatant into a new 50 mL Falcon tube.

'''Protein Extraction and RNAse treatment''' Add 1 volume of chloroform: isoamyl alcohol to the solution and mix by inversion for 5 min. Centrifuge the sample for 10 min at 5000 × g and pipette the upper aqueous phase into a new Falcon tube, taking care to avoid the aqueous/organic layer interface. Add 5 μL of RNAse A (10 mg/mL) to the solution and incubate at 37°C for 15 min with periodic, gentle mixing. After incubation, add 1 volume of chloroform: isoamyl alcohol to the solution and mix by inversion for 5 min. Centrifuge the solution for 10 min at 5000 × g and pipette the aqueous phase into a new Falcon tube, again taking care to avoid the organic layer.

'''Precipitation''' Add ½ volume of 5 M NaCl to the sample and mix gently by inversion. Then, add 3 volumes of cold 95% ethanol and mix gently by inversion. Place the tubes into a -20°C freezer and incubate for 1 h. NOTE: do not leave the sample at -20°C for more than 1 h as both the CTAB and NaCl can precipitate from solution, preventing DNA isolation.

After incubation, centrifuge the Falcon tube for 10 min at 5000 × g to pellet the DNA. Carefully decant away the supernatant and wash the DNA pellet with 3 mL of 70% ethanol. Gently swirl the solution and centrifuge again for 10 min at 5000 × g. Carefully decant the supernatant and air-dry DNA pellet for 15 min at room temperature. Once dried, suspend DNA in 200 μL of TE buffer.

'''DNA quality and quantity assessment''' Assess the quality of the extracted DNA using a NanoDrop UV/Vis spectrophotometer and 0.7% (w/v) agarose gel, looking for a single absorbance peak at 260 nm, a 260/280 absorbance ratio of 1.8-2.0, and no evidence of substantial band shearing or contamination (either RNA or polysaccharide).
[[Category:Protocols]]

File:IMG 1541.JPG

2016-08-24T18:06:09Z

Excellgen:

File:Corn genomic DNA extraction.JPG

2016-08-24T18:04:38Z

Excellgen:

File:DNA extraction from corn.JPG

2016-08-24T16:15:02Z

Excellgen:

File:Miniprep comparison.JPG

2016-08-24T15:23:46Z

Excellgen:

File:Corn genomic DNA.JPG

2016-08-18T22:23:38Z

Excellgen:

Transfection20160727

2016-08-01T21:54:34Z

Excellgen:

Day 2

[[File:Transfection20160727.jpg|RTENOTITLE]]

{| border="1" cellpadding="1" cellspacing="1" width="399"
|-
| style="width: 141.667px" | Sample number 
| style="width: 1px" | 
| style="width: 33px" | 
| style="width: 35px" | 
| style="width: 34px" | 
| style="width: 42px" | 
| style="width: 210px" | 
|-
| style="width: 141.667px" | H2O 
| style="width: 1px" | 1:66.7 
| style="width: 33px" | 1:50 
| style="width: 35px" | 1:25 
| style="width: 34px" | 1:20 
| style="width: 42px" | 1:13.3 
| style="width: 210px" | Control: L2K 
|-
| style="width: 141.667px" | DMSO 
| style="width: 1px" | 1:66.7 
| style="width: 33px" | 1:50 
| style="width: 35px" | 1:25 
| style="width: 34px" | 1:20 
| style="width: 42px" | 1:13.3 
| style="width: 210px" | Control: L2K 
|-
| style="width: 141.667px" | H2O 
| style="width: 1px" | 1:66.7 
| style="width: 33px" | 1:50 
| style="width: 35px" | 1:25 
| style="width: 34px" | 1:20 
| style="width: 42px" | 1:13.3 
| style="width: 210px" | Control: L2K 
|-
| style="width: 141.667px" | DMSO 
| style="width: 1px" | 1:66.7 
| style="width: 33px" | 1:50 
| style="width: 35px" | 1:25 
| style="width: 34px" | 1:20 
| style="width: 42px" | 1:13.3 
| style="width: 210px" | Control: L2K 
|}

[[File:IMG 1546.JPG|RTENOTITLE]]

Day 4

[[File:IMG 1548.JPG|RTENOTITLE]]

Day 7

[[File:Transfection20160801.JPG]]
[[Category:Transfection]]

File:Transfection20160801.JPG

2016-08-01T21:53:33Z

Excellgen:

File:IMG 1548.JPG

2016-07-29T17:51:36Z

Excellgen:

File:Transfection20160727.jpg

2016-07-27T15:46:31Z

Excellgen:

File:IMG 1546.JPG

2016-07-27T15:46:20Z

Excellgen:

File:Genomic DNA extraction.jpg

2016-07-22T20:39:18Z

Excellgen:

File:IMG 1516.JPG

2016-07-19T18:35:05Z

Excellgen:

Cre QC 20160719

2016-07-19T14:29:32Z

Excellgen:

[[File:Cre QC 20160719.jpg|RTENOTITLE]]

{| style="width: 414px" border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 88px; text-align: center" | Lot:95-1708 
| style="width: 59px; text-align: center" | Control 
| style="width: 58px; text-align: center" | 0.5 um 
| style="width: 60px; text-align: center" | 1 um 
| style="width: 59px; text-align: center" | 2.5 um 
| style="width: 61px; text-align: center" | 5 um 
|-
| style="width: 88px; text-align: center" | Lot:96-1708 
| style="width: 59px; text-align: center" | Control 
| style="width: 58px; text-align: center" | 0.5 um 
| style="width: 60px; text-align: center" | 1 um 
| style="width: 59px; text-align: center" | 2.5 um 
| style="width: 61px; text-align: center" | 5 um 
|-
| style="width: 88px; text-align: center" | Lot:97-1708 
| style="width: 59px; text-align: center" | Control 
| style="width: 58px; text-align: center" | 0.5 um 
| style="width: 60px; text-align: center" | 1 um 
| style="width: 59px; text-align: center" | 2.5 um 
| style="width: 61px; text-align: center" | 5 um 
|-
| style="width: 88px; text-align: center" | Lot:20130826 
| style="width: 59px; text-align: center" | Control 
| style="width: 58px; text-align: center" | 0.5 um 
| style="width: 60px; text-align: center" | 1 um 
| style="width: 59px; text-align: center" | 2.5 um 
| style="width: 61px; text-align: center" | 5 um 
|}

 
[[Category:QC]]

File:Cre QC 20160719.jpg

2016-07-19T14:24:17Z

Excellgen:

2X PCR buffer

2016-07-16T19:11:08Z

Excellgen: Excellgen moved page 2X PCR buffer to 2X PCR buffer 6/30/2016

#REDIRECT [[2X PCR buffer 6/30/2016]]

2X PCR buffer 6/30/2016

2016-07-16T19:11:08Z

Excellgen: Excellgen moved page 2X PCR buffer to 2X PCR buffer 6/30/2016

PCR using--- as template, T7-F and T7-R as primers

{| border="1" cellpadding="1" cellspacing="1" width="373"
|-
| rowspan="5" style="width: 220px; text-align: center" colspan="1" | 2X buffer with 1.5 mM Mgcl2  final conc 
| style="width: 58px; text-align: center" | Control 
| style="width: 84px; text-align: center" | 2.5U NEB Taq 
|-
| style="width: 58px; text-align: center" | 1 
| style="width: 84px; text-align: center" | 0.5U Taq 
|-
| style="width: 58px; text-align: center" | 2 
| style="width: 84px; text-align: center" | 1U Taq 
|-
| style="width: 58px; text-align: center" | 3 
| style="width: 84px; text-align: center" | 2.5U Taq 
|-
| style="width: 58px; text-align: center" | 4 
| style="width: 84px; text-align: center" | 5U Taq 
|-
| rowspan="5" style="width: 220px; text-align: center" colspan="1" | 2X buffer with 2.5 mM Mgcl2 final conc 
| style="width: 58px; text-align: center" | Control 
| style="width: 84px; text-align: center" | 2.5U NEB Taq 
|-
| style="width: 58px; text-align: center" | 5 
| style="width: 84px; text-align: center" | 0.5U Taq 
|-
| style="width: 58px; text-align: center" | 6 
| style="width: 84px; text-align: center" | 1U Taq 
|-
| style="width: 58px; text-align: center" | 7 
| style="width: 84px; text-align: center" | 2.5U Taq 
|-
| style="width: 58px; text-align: center" | 8 
| style="width: 84px; text-align: center" | 5U Taq 
|}

20 cycle

[[File:2X buffer 20 cycle.JPG|RTENOTITLE]]

25 cycle

[[File:2X buffer 25 cycle.JPG|RTENOTITLE]]

30 cycle

[[File:2X buffer 30 cycle.JPG|RTENOTITLE]]

35 cycle

[[File:2X buffer 35 cycle.JPG|RTENOTITLE]]

6/30/2016

template 528 pLVX-IRES-EGFP， IRES-Xho1-F +  IRES-Mlu1-R， product 1.3 kb
<pre>ctcgag TACGTAAATTCCGCCCCTCTCCCTAACGTT

ACTGGCCGAA

GCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTC
TTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTC
TGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTG
CGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAA
AGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAA
KpnI
GGTACC
CCATTGTATGGGATCTGATC
TGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGT
TTTCCTTTGAAAAACACGATGATAATATGGCCACAACC

EGFP
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT
CCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAG
CTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC
AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCG
CACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATC
GAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCT
ATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCT
CGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCC
GCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA
TGGACGAGCTGTACAAGTAA

ACGCGT</pre>

PCR primers
<pre>IRES-Xho1-F  2011_12_22    H10  ATCGCACTCGAGTACGTAAATTCCGCCCCTCTC
Xho1
atcgca ctcgag TACGTAAATTCCGCCCCTCTC</pre>

<pre>IRES-Mlu1-R 2011_12_22    H11     GATGCGTACGCGTTTACTTGTACAGCTCGTCCATG
(CATGGACGAGCTGTACAAGTAA ACGCGT acgcatc)
gatgcgtACGCGTTTACTTGTACAGCTCGTCCATG</pre>
[[Category:QC]]

Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml

2016-07-16T19:08:58Z

Excellgen: Excellgen moved page Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml to Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml 22 June 2016

#REDIRECT [[Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml 22 June 2016]]

Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml 22 June 2016

2016-07-16T19:08:58Z

Excellgen: Excellgen moved page Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml to Taq 130U/ul, 67-2038, 4mg/ml, 2mg/ml 22 June 2016

[[File:Taq differen lot.JPG|RTENOTITLE]]

{| style="width: 266px" border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 41px" | Lane 2 
| style="width: 213px" | Taq 130U/ul  1:13 
|-
| style="width: 41px" | 3 
| style="width: 213px" | Taq 130U/ul  1:6.5 
|-
| style="width: 41px" | 4 
| style="width: 213px" | Taq 130U/ul   1:4 
|-
| style="width: 41px" | 5 
| style="width: 213px" | Taq 130U/ul   1:3 
|-
| style="width: 41px" | 6 
| style="width: 213px" | Taq 67-2038   1:30 
|-
| style="width: 41px" | 7 
| style="width: 213px" | Taq 67-2038    1:15 
|-
| style="width: 41px" | 8 
| style="width: 213px" | Taq 67-2038   1:10 
|-
| style="width: 41px" | 9 
| style="width: 213px" | Taq 67-2038   1:7.5 
|-
| style="width: 41px" | 10 
| style="width: 213px" | Taq 4mg/ml    1:40 
|-
| style="width: 41px" | 11 
| style="width: 213px" | Taq 4mg/ml    1:20 
|-
| style="width: 41px" | 12 
| style="width: 213px" | Taq 4mg/ml    1:13 
|-
| style="width: 41px" | 13 
| style="width: 213px" | Taq 4mg/ml    1:10 
|-
| style="width: 41px" | 14 
| style="width: 213px" | Taq 2mg/ml    1:20 
|-
| style="width: 41px" | 15 
| style="width: 213px" | Taq 2mg/ml     1:10 
|-
| style="width: 41px" | 16 
| style="width: 213px" | Taq 2mg/ml     1:6.5 
|-
| style="width: 41px" | 17 
| style="width: 213px" | Taq 2mg/ml     1:5 
|}
[[Category:QC]]

Taq different lot

2016-07-16T19:08:21Z

Excellgen: Excellgen moved page Taq different lot to Taq different lot 2016/06/23

#REDIRECT [[Taq different lot 2016/06/23]]

Taq different lot 2016/06/23

2016-07-16T19:08:21Z

Excellgen: Excellgen moved page Taq different lot to Taq different lot 2016/06/23

2016/06/23

[[File:Taq differen lot.JPG|RTENOTITLE]]

{| border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 41px" | Lane 2 
| style="width: 213px" | Taq 130U/ul  1:13 
|-
| style="width: 41px" | 3 
| style="width: 213px" | Taq 130U/ul  1:6.5 
|-
| style="width: 41px" | 4 
| style="width: 213px" | Taq 130U/ul   1:4 
|-
| style="width: 41px" | 5 
| style="width: 213px" | Taq 130U/ul   1:3 
|-
| style="width: 41px" | 6 
| style="width: 213px" | Taq 67-2038   1:30 
|-
| style="width: 41px" | 7 
| style="width: 213px" | Taq 67-2038    1:15 
|-
| style="width: 41px" | 8 
| style="width: 213px" | Taq 67-2038   1:10 
|-
| style="width: 41px" | 9 
| style="width: 213px" | Taq 67-2038   1:7.5 
|-
| style="width: 41px" | 10 
| style="width: 213px" | Taq 4mg/ml    1:40 
|-
| style="width: 41px" | 11 
| style="width: 213px" | Taq 4mg/ml    1:20 
|-
| style="width: 41px" | 12 
| style="width: 213px" | Taq 4mg/ml    1:13 
|-
| style="width: 41px" | 13 
| style="width: 213px" | Taq 4mg/ml    1:10 
|-
| style="width: 41px" | 14 
| style="width: 213px" | Taq 2mg/ml    1:20 
|-
| style="width: 41px" | 15 
| style="width: 213px" | Taq 2mg/ml     1:10 
|-
| style="width: 41px" | 16 
| style="width: 213px" | Taq 2mg/ml     1:6.5 
|-
| style="width: 41px" | 17 
| style="width: 213px" | Taq 2mg/ml     1:5 
|}
[[Category:QC]]

2X PCR buffer 2016-07-15

2016-07-15T18:32:11Z

Excellgen:

[[File:2X PCR buffer comparison.JPG]]

{| style="width: 291px" border="1" cellpadding="1" cellspacing="1"
|-
| style="width: 40px" | Lane 1 
| style="width: 239px" | 1 kb ladder 
|-
| style="width: 40px" | Lane 2 
| style="width: 239px" | 2X Taq Master Mix,novoprotein 
|-
| style="width: 40px" | Lane 3 
| style="width: 239px" | Lot:67-2038, 2X buffer with 400U Taq 
|-
| style="width: 40px" | Lane 4 
| style="width: 239px" | Lot:2324, 2X buffer with 400U Taq 
|-
| style="width: 40px" | Lane 5 
| style="width: 239px" | Lot:100-2038, 2X buffer with 400U Taq 
|-
| style="width: 40px" | Lane 6 
| style="width: 239px" | 2X buffer 
|}

[[Category:QC]]

File:2X PCR buffer comparison.JPG

2016-07-15T18:27:04Z

Excellgen: