ELN - User contributions [en]

File:IMG 1308.JPG

2011-08-26T20:43:50Z

Hylei:

Multiple clones pAd5

2011-08-26T20:43:25Z

Hylei:

== '''SubCloning of fluorescent fragments to pAd5-MCS (280)''' ==

'''Purpose:''' SubCloning of fluorescent fragments to pAd5-MCS (280).

'''Date: '''2011-8-23

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Haiyan

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-23

Release fragments with Xhoi + BamH1 

Digest pAd5-MCS (clone #280) with Xhoi + BamH1 

cut out insert (1-9) and vector (10, 11), ligate and transform STBL3 [[Image:0823.jpg]] 

{| width="200" cellspacing="1" cellpadding="1" border="1"
|-
! scope="row" | lane
| 1
| 2 
| 3 
| 4 
| 5 
| 6 
| 7 
| 8 
| 9 
| 10 
| 11 
| 12 
| 13 
| 
| 
|-
! scope="row" | plasmid
| lss-mkate2
| IFP 
| RFP 
| eEGFP 
| NEPTUNE 
| BFP 
| YFP 
| mkate2 
| CFP 
| 280 
| 280 
| plenti-YFP1 
| plenti-YFP2 
| 
| 
|}

lane 12, 13 colonies screenign fro plenti-YFP 

lane 14, 15 colonies screenign fro pAAV-YFP 

=== Colony Screening ===

Date: 2011-8-26 

Make miniprep and digest with xhoi + BamH1 

[[Image:0826-1.jpg]]

Lane 1-4: pAd5-LSS-mkate2 (365) bamhi+xhoi 

Lane 5-8: pAd5-IFP (234) bamhi+xhoi 

Lane 9-12: pAd5-RFP (230)bamhi+xhoi 
Lane 13-16: pAd5-EGFP (304)bamhi+xhoi 

Pick up 1, 6, 9, 15 to freeze DNA and bacteria. 

[[Image:0826-2.jpg]]

Lane 17-20: pAd5- Neptune (366) bamhi+xhoi 

Lane 21-24: pAd5-BFP (233) bamhi+xhoi 

Lane 25-28: pAd5-YFP (231)bamhi+xhoi 
Lane 29-31: pAAV-mKate2 (228)bamhi+xhoi 
Lane 32: pAd5-cfp (232)bamhi+xhoi 

Pick up 17, 22, 26, 30, 32 to freeze DNA and bacteria. 
 

== '''Result intepretation/Summary''' ==

*PKAalpha 3+4 has one internal Xho1 site. GFP-Puro can be cut out with Xho1 + Mlu1. So Lane 1 has correct number of bands.
*PKA alpha 3+4 with CMV promoter can be cut out with Nde1+ BamH1. Lane 5 has correct number of bands.
*lane 6 maybe good (incomplete digestion)
*Sequencing Result: 

== '''Conclusion''' ==

Restriction digestion 

shows  pLentiGP clone #1 may be good, 

pLVGP-PKAalpha 3+4 is good 

=== ===

[[User:Paul.xu|Paul.xu]] 08:23, 15 June 2011 (EST) 

[[Category:Cloning]]

File:0826-2.jpg

2011-08-26T20:15:47Z

Hylei: uploaded a new version of "File:0826-2.jpg"

File:0826-1.jpg

2011-08-26T19:41:26Z

Hylei:

File:PLenti dest pAd5 CMV dest 2011 8 25.jpg

2011-08-25T22:34:02Z

Hylei:

File:0823.jpg

2011-08-23T20:00:12Z

Hylei:

Plenti-gluc-pka-301

2011-08-22T17:32:52Z

Hylei:

== '''SubCloning of PKA alpha to pLentiGP''' ==

'''Purpose:''' Subcloning of PKA alpha to pLentiGP for expression of PKA in 293 cells with GFP screening.

'''Date: '''2011-6-8 to 2011-6-16

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Paul, Haiyan, Ruili

== '''Results''' ==

=== Subcloning ===

=== Test whether the 299_plentigp_gluc is the good vector for the 301_gluc_pka === Date: 2011-08-08

 [[Image:0808 app pcr 0808.JPG]] 

Lane 7 &8 : 299_plentigp_gluc as tmp, cmv-f/gluc-r primer set, pcr amplify 

explaination: two plasmids both have the amplified bands, the vector should no problem. 

Date: 2011-08-08

[[Image:0808 gluc vector 0808.JPG]] 

Lane 1-4: 299_plentigp_gluc vector 1, 2, 3 and 219_plentigp nhei+xhoi 

Lane 5-8: 299_plentigp_gluc vector 1, 2, 3 and 219_plentigp nhei+bamhi 

299_plentigp_gluc vector is still the good vector, lane 1 ligate with the annealed pka to do transform

 

=== Colony screening === 

 Date: 2011-08-10

 [[Image:IMG 1253.JPG]] CMV-F/pka-xhoi-r primer for colonies screening, 12 colonies, other 2 colonies in other figs, same band with colonies 3, 4. seems lane 7 has the longer band, others has the short band. Grow lane 6,7,8,9 to do miniprep.

 

Date: 2011-08-11

 [[Image:0811-pka.JPG]] Lane 1: Marker Lane 2, pka 6 (above lane 6) bamhi+xhoi Lane 3, pka 7 (above lane 7) bamhi+xhoi Lane 4, pka 8 (above lane 8) bamhi+xhoi Lane 5, pka 9 (above lane 9) bamhi+xhoi Lane 6, pka-gluc (vector for pka-gluc) bamhi+xhoi Lane 7, pka-gluc (vector for pka-gluc) bamhi+xhoi Lane 8, pka 6 (above lane 6) nhei+xhoi Lane 9, pka 7 (above lane 7) nhei+xhoi Lane 10, pka 8 (above lane 8) nhei+xhoi Lane 11, pka 9 (above lane 9) nhei+xhoi Lane 12, pka-gluc (vector for pka-gluc) nhei+xhoi Lane 13, pka-gluc (vector for pka-gluc) nhei+xhoi 

we think lane 3 (clone 7) should be positive clone. 

after sequencing, clone 7 has lot mutation, could not use 

2011-08-19 

[[Image:0819.jpg]] lane 1-2: pet 28b-lss-mkate 2 (229) bamhi+xhoi lane 3: plentigp-gluc (299) nhei+xhoi lane 4: pET3a-Muts (352) ndei+ecoi lane 5: pET3a-Muts (352) ndei+hindiii lane 6: pET28b ndei+ecoi lane 7: pET28b ndei+hindiii lane 8: pdbhisMBP ndei+ecoi lane 9: pdbhisMBP ndei+HINDIII Lane 10: pET3a-Muts (352) tmp, pcr amplify lane 11-13, pka1, primer :PKAalpha-Nhe1-F1/PKAalpha-6His-Xho1-R1, tmp pkaalpha lane 14-16: pka2, primer :PKAalpha-Nhe1-F2/PKAalpha-6His-Xho1-R2, tmp pkaalpha for the pcr amplify, fusion enzyme, 95, 68 3min extension. 

Date: 2011-7-13

[[Image:Pka+gluc.JPG]] 

Lane 1: pka1, primer :PKAalpha-Nhe1-F1/PKAalpha-6His-Xho1-R1, tmp pkaalpha 

Lane 2: pka2, primer :PKAalpha-Nhe1-F2/PKAalpha-6His-Xho1-R2, tmp pkaalpha 

Lane 3: gluc,primer :GLuc1 BamH1 A8/Gluc-Nhe1-R Nhe1, tmp: pET28b-Gluc (ID: 301) 

Phusion enzyme, 25 cycle

digest plentiGP with Nhei/Xhoi (for pka) and plentiGP with Nhei/Bamhi (for Gluc)

anneal the pka pcr fragment and ligate with plentiGP with Nhei/Xhoi; Nhei/Bamhi digest the Gluc PCR fragment and ligate with plentiGP with Nhei/Bamhi transform STBL3 

 

=== Colony Screening ===

Date: 2011-7-15 

 [[Image:App.JPG]] Lane 1: Marker Lane 2+3: gluc,primer :GLuc1 BamH1 A8/Gluc-Nhe1-R Nhe1, tmp: pET28b-Gluc (ID: 301), NheI+BamHI Lane 4: plentiGP with Nhei/Bamhi (for Gluc) Lane 5+6: App,primer :AmyloidBP-F/AmyloidBP-r, tmp: pCMV-SPORT6-App (ID: 305), NheI+BamHI Lane 7: plentiGP with Nhei/Bamhi (for app) Lane 8: plentiGP with Nhei/Xhoi (for pka) Phusion enzyme, 25 cycle ligate 2+3 with 4' 5+6 with 7. anneal the pka pcr fragment and ligate with plentiGP with Nhei/Xhoi; Nhei/Bamhi digest the Gluc PCR fragment and ligate with plentiGP with Nhei/Bamhi transform STBL3 2011-7-16 [[Image:App+gluc.JPG]] Lane 1: Marker Lane 2: plentiGP with Nhei/Bamhi Lane 3 &4: app pcr amplify, cut with Nhei/Bamhi Lane 5 to Lane 8: plenti-gluc cut with Nhei/Bamhi seq Lane 5 ligate Lane 2 with Lane 3&4. 

2011-7-16 PCR Amplify to screen colonies for pet30-his, primer set: T7R/Pet 8 His-s [[Image:Pet 30 -his.JPG]] Lane 1: Marker Lane 2: colonie 1 Lane 3: colonie 2 Lane 4: colonie 3 Lane 5: colonie 4 Lane 6: pet 30b template to amplify lane 2,3,5 should be positive; seq lane 2; 

 2011-7-25 colonies screen for 303_pLentiGP-App [[Image:App+pka.JPG]] Lane 1: pka1, primer :PKAalpha-Nhe1-F1/PKAalpha-6His-Xho1-R1, tmp pkaalpha 

Lane 2: pka2, primer :PKAalpha-Nhe1-F2/PKAalpha-6His-Xho1-R2, tmp pkaalpha Lane 3: 299_plentiGluc NCOI+XHOI digestion Lane 4-8: colonie screening for 303_pLentiGP-App 

seq lane 4 failed, try seq lane 8 again; 

 2011-7-25 subclone 256, 241 cre to pet8his [[Image:Cre+p.JPG]] Lane 1: Marker 

Lane 2,3: 256_pAAV-cre Ncoi+xhoi Lane 4,5: 241 plentigp-cre NCOI+XHOI digestion Lane 6,7: 286 pet 8His NCOI+XHOI digestion 

ligate 2,3 with lane 6; ligate 4,5 with lane 7; 

2011-07-25 colonies screening for 300_plenti-gluc-pka and pet8his-cre [[Image:Pka+cre-0725.JPG]] Lane 1: Marker Lane 2-8: plenti-gluc-pka colonies 1-7 nhei+xhoi Lane 9-13: 256_pAAV-cre Ncoi+xhoi cut and ligate with pet8his cut Lane 14-18: 241_pAAV-cre Ncoi+xhoi cut and ligate with pet8his cut seq lane 13 

 

 2011-07-26 colonies screening for 300_plenti-gluc-pka [[Image:Pka-0725.JPG]] Lane 1: Marker Lane 2-8: plenti-gluc-pka colonies 1-7 nhei+xhoi Lane 9-12: plenti-gluc-pka colonies 1-7 pcr amplify, using gluc1-a8 and pka-xhoi r primer for other 3 colonies, got same pcr amplify band, data not showing It is possible Nhei site does not work now, but has the pka insert. 

2011-07-27 miniprep kit comparison [[Image:Kit comparison.JPG]] 5ul/50ul run gel, Kit order: Qiagen, Original, Omega, introbio Lane 1: Marker Lane 2-5: dsAAV_SMN1, lane 2, 30ng/ul, 260/280 is 2.02; lane 3, 330ng/ul, 260/280 is 1.19; lane 4, 10ng/ul, 260/280 is ---; lane 5, 40ng/ul, 260/280 is 1.3; Lane 6-9: dsAAV_SMN2, 

Lane 10-13: plenti-app, 

 

2011-07-27 medium prep DNA quality check and pka-gluc colonies check [[Image:Medium prep-0726.JPG]] Lane 1: Marker lane 2, pAAV-MCS lane 3, Pet8His; lane 4, pAAV-CRE lane 5, PLENTI-MKATE2 lane 6, PKA-GLUC BAMHI+XHOI lane 7, PKA-GLUC NHEI+XHOI lane 8, PKA-GLUC BAMHI+NHEI Throw away lane 4,5; seems no positive for pka-gluc. 

2011-07-29 PCR check app colonies and pka-gluc colonies check [[Image:0729-app.JPG]] 

Lane 1: Marker lane 2-7, cmv-f/amyloid-r pcr amplify for colonies 1-6 lane 8-9, bghr/amyloid-f pcr amplify for colonies 1-2, plus the following picture; [[Image:0729-pka.JPG]] 

 lane 1-6, bghr/amyloid-f pcr amplify for colonies 1-6, overlap with the upper picture lane 7-9, PLENTI-pka-gluc nhei+xhoi lane 9 positive clone, seq 

 

== '''Result intepretation/Summary''' ==

== '''Conclusion''' ==

Restriction digestion 

shows  pLentiGP clone #1 may be good, 

pLVGP-PKAalpha 3+4 is good 

 

 

=== ===

[[User:Paul.xu|Paul.xu]] 08:23, 15 June 2011 (EST) 

[[Category:Cloning]]

353 pET28b-TaqMuts

2011-08-21T23:07:16Z

Hylei:

== '''Cloning of TaqMuts to pET28b''' ==

'''Purpose:''' SubCloning of TaqMuts from pET30a to the pET28b (353).

'''Date: '''2011-8-19 to 2011-8-23

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Paul 

== '''Results''' ==

=== Digestion Analysis ===

Date: 2011-8-19 

[[Image:PET3A Taq Muts digestion 8 18 2011 1.jpg]] 

[[Image:PET3A Taq Muts digestion 8 19 2011 2.jpg]] 

{| width="200" cellspacing="1" cellpadding="1" border="1"
|-
| Lane 
| Sample 
| Digestion 
|-
| 1 
| pET3a-Muts 
| Nde1+EcoR1 
|-
| 2 
| pET3a-Muts 
| NdeI+HindIII 
|-
| 3 
| pET3a-Muts 
| NdeI+BamH1 
|-
| 4 
| pET3a-Muts 
| BamH1 
|-
| 5 
| pDB.His.MBP 
| NdeI+EcoR1 
|-
| 6 
| pET28b 
| NdeI+EcoR1 
|}

Looks like there is no HindIII and EcoR1 sites in pET3a_Muts 

From published paper, the TaqMuts cDNA can be cut out with NdeI+ BamH1, but there is a BamH1 site within the gene. 

=== PCR ===

Date: 2011-8-19

Primer F: Taq-Muts-F cata cat atggaaggcat gctgaagggc Primer-R: Taq-Muts-R cgatgaattctcaccccttcatggtatccaag 

[[Image:MutS PCR 8 19 2011.jpg]] 

Cut out TaqMuts bands, purify with spin column.

Digest with NdeI + EcoR1, ligate to NdeI+ EcoR1 digested pET28b.

Transform 10 ul using STBL3, grow on LB/Kan O/N 

=== Colony Screening ===

Date: 2011-8-21 [[Image:PET28b-TaqMuts_NdeI_EcoR1_2011_8_21.jpg]] 

digest 5 ul DNA with NdeI + EcoR1

clone 2 & 6 look good.

send clone 2 for sequencing T7-F and T7-R

== '''Result intepretation/Summary''' ==

* 

== '''Conclusion''' ==

[[Category:Cloning]]

File:PET28b-TaqMuts NdeI EcoR1 2011 8 21.jpg

2011-08-21T23:04:51Z

Hylei:

280 pAd5-CMV-MCS

2011-08-20T20:44:42Z

Hylei:

== '''Convert pAd5-CMV-IRES-GFP (227) to pAd5-CMV-MCS (280)''' ==

'''Purpose:''' convert pAd5-CMV-IRES-GFP to pAd5-CMV-MCS 

'''Date: '''8-18-2011

'''Notebook:'''Paul

'''Page:''' x

'''Clone ID: '''280

'''Experimenters:''' Paul

== '''Results''' ==

=== Digestion ===

Date: 2011-8-18

Remove GFP

Digest pAd5-CMV-IRES-GFP (227) with KpnI + NotI, cut out vector (not two small fragments), gel purify, 

Ligate with ligate with annealed pAD5-MCS-T3 + pAD5-MCS-B3, for 1 hour at RT, transform STBL3 with 10 ul ligation mix. 

=== Colony Screening ===

Date: 2011-8-20 

Make miniprep and digest with Xba1+ Nde1 

cut our promoter (partly) using NdeI + XbaI, Xba1 is introduced by oligos (pAD5-MCS-T3 + pAD5-MCS-B3) 

[[Image:280 pAd5-CMV-MCS 8 20 2011.jpg]] 

== '''Result intepretation/Summary''' ==

*clone # 1, 2, 4 look good 
*Miniprep OD260

{| cellspacing="1" cellpadding="1" border="1" style="width: 238px; height: 84px;"
|-
| 
| ng/ul
| 260/280
|-
| #1
| 7.5
| 1.72
|-
| #2
| 11
| 2.1
|-
| #4
| 15
| 1.9
|}

*sequencing, #4

== '''Conclusion''' ==

 --[[User:Hylei|Hylei]] 15:35, 20 August 2011 (EST)

[[Category:Cloning]]

File:MutS PCR 8 19 2011.jpg

2011-08-20T20:10:19Z

Hylei:

File:PET3A Taq Muts digestion 8 18 2011 1.jpg

2011-08-20T20:10:05Z

Hylei:

File:PET3A Taq Muts digestion 8 19 2011 2.jpg

2011-08-20T20:09:37Z

Hylei:

File:280 pAd5-CMV-MCS 8 20 2011.jpg

2011-08-20T19:20:40Z

Hylei:

PAd5-CMV-MCS

2011-08-20T19:15:36Z

Hylei: moved PAd5-CMV-MCS to 280 pAd5-CMV-MCS

#REDIRECT [[280 pAd5-CMV-MCS]]

File:0819.jpg

2011-08-19T20:33:01Z

Hylei:

Multiple clones

2011-08-18T19:35:16Z

Hylei:

== '''Subcloning of egfp, rfp, mnatue from pet 28b to pLenti and paav vector''' ==

'''Purpose:''' Subcloning of egfp, rfp, mnatetune, ifp from pet 28b to pLenti and paav vector .

'''Date: '''2011-8-18

'''Notebook:''' Haiyan

'''Page:'''003025

'''Clone ID:''' pLenti-IFP (226), pLenti-RFP (221),plenti-EGFP (344), plenti -mnatetuen (345), pLenti-BFP (223), paav-mnatetuen (346), pAAV-CMV-IFP (285),pAAV-rfp (347), paav-egfp (348)

'''Experimenters:''' Haiyan

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-18

Digest fragments from pet 28b vector using bamhi+xhoi 

Digest paav-mcs or plentiplus with bamhi+xhoi 

cut out insert and vector, ligate and transform STBL3

=== Colony Screening ===

Date: 2011-8-18 

Make miniprep and digest with bamhi+xhoi 

[[Image:0818-1.jpg]]

Lane 1-4: pLenti-IFP (226) clone 1-4, bamhi+xhoi 

Lane 5-8: plenti -mnatetuen (345), clone 1-4, bamhi+xhoi 

Lane 9-12: pLenti-RFP (221), clone 1-4, bamhi+xhoi 

Lane 13-16: pLenti-BFP (223), clone 1-4, bamhi+xhoi 

[[Image:IMG_1274.JPG]]

Lane 2-5: plenti-EGFP (344) clone 1-4, bamhi+xhoi 

Lane 6-9: paav-mnatetuen (346), clone 1-4, bamhi+xhoi 

Lane 10-11: pAAV-CMV-IFP (285), clone 1-2, bamhi+xhoi 

[[Image:IMG_1275.JPG]]

Lane 1-2: pAAV-CMV-IFP (285), clone 3-4, bamhi+xhoi 

Lane 3-6: pAAV-rfp (347), clone 1-4, bamhi+xhoi 

Lane 7-10: paav-egfp (348), clone 1-4, bamhi+xhoi 

== '''Result intepretation/Summary''' ==

Got all the positive colonies for above clones 

== '''Conclusion''' ==

=== ===

[[User:Haiyan]] 08:23, 18 Aug 2011 (EST) 

[[Category:Cloning]]

File:0818-1.jpg

2011-08-18T19:16:12Z

Hylei:

File:0818.jpg

2011-08-18T15:56:06Z

Hylei:

File:IMG 1274.JPG

2011-08-18T15:55:48Z

Hylei:

File:IMG 1272.JPG

2011-08-15T18:36:10Z

Hylei:

253 pET28b-T4 Ligase

2011-08-15T18:31:32Z

Hylei: Created page with "== '''gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp''' == '''Purpose:''' gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp. '''Date: ..."

== '''gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp''' ==

'''Purpose:''' gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp.

'''Date: '''2011-8-15

'''Notebook:''' Haiyan

'''Page:'''003023

'''Clone ID:''' 253

'''Experimenters:''' Haiyan

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-15

[[Image:IMG_1271.JPG]]

PCR amplify T4 dna ligase and Digest with NdeI + xhoi, lane 1-3 

Digest pet 28b (lane 4) and pdbhis.mbp (lane 5, 6) with NdeI + xhoi 

Result: T4 dna ligase no amplify bands, using fusion enzyme to amplify again. 

=== Colony Screening ===

Date: 2011-8-15 

Make miniprep and digest with NdeI + BamH1 

[[Image:PLentiGP-PKAalpha 6 14 2011 2.JPG]]

Lane 1: pLVGP-PKAalpha 3+4, Xho1 + Mlu1 

Lane 2: pLentiGP #1, Xho1 + Mlu1 

Lane 3: pLentiGP #6, Xho1 + Mlu1 

Lane 4: pLVGP #1, Xho1 + Mlu1 

Lane 5: pLVGP-PKAalpha 3+4, Nde1+ BamH1 

Lane 6: pLentiGP 1, Nde1+ BamH1

Lane 7: pLentiGP 6, Nde1+ BamH1

Lane 9: pLVGP1, Nde1+BamH1

== '''Result intepretation/Summary''' ==

*PKAalpha 3+4 has one internal Xho1 site. GFP-Puro can be cut out with Xho1 + Mlu1. So Lane 1 has correct number of bands.
*PKA alpha 3+4 with CMV promoter can be cut out with Nde1+ BamH1. Lane 5 has correct number of bands.
*lane 6 maybe good (incomplete digestion)
*Sequencing Result: 

== '''Conclusion''' ==

Restriction digestion 

shows  pLentiGP clone #1 may be good, 

pLVGP-PKAalpha 3+4 is good 

=== ===

[[User:Paul.xu|Paul.xu]] 08:23, 15 June 2011 (EST) 

[[Category:Cloning]]

File:IMG 1271.JPG

2011-08-15T18:25:23Z

Hylei:

224 PLenti-cfp

2011-08-15T18:21:22Z

Hylei: Created page with "== '''SubCloning of CFP to pLentiplus''' == '''Purpose:''' Subcloning of cfp to pLentiplus from pAAV-CFP. '''Date: '''2011-8-15 '''Notebook:''' hAIYAN '''Page:''' 003019 ..."

== '''SubCloning of CFP to pLentiplus''' ==

'''Purpose:''' Subcloning of cfp to pLentiplus from pAAV-CFP.

'''Date: '''2011-8-15

'''Notebook:''' hAIYAN

'''Page:''' 003019

'''Clone ID:''' 224

'''Experimenters:''' Haiyan

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-15 

Digest pAAV-CFP with BamH1 + Xho1 

Run gel and cut out insert

Digest pLentiPlus with BamH1 + Xho1

Run gel and cut out vector combine and purify using spin column

Ligate and transform STBL3

=== Colony Screening ===

Date: 2011-8-15

Make miniprep and digest pLenti-CFP with BamHI + Xho1

 [[Image:IMG_1269.JPG]]

Lanes 6-9: pLenti-CFP clone 1-4, BamHI + Xho1 

== '''Result intepretation/Summary''' ==

*clone 1,2,3 should be positive clone 

== '''Conclusion''' ==

finish clone 224 

=== ===

[[User:Haiyan]] 11:33, 08/15/2011 (EST) 

[[Category:Cloning]]

File:IMG 1269.JPG

2011-08-15T18:14:25Z

Hylei:

Yolanda Cloning

2011-08-12T19:08:58Z

Hylei:

8/4/2011

[[Image:Adx Lentivirus EcoRI BAMHI 2011 8 4.JPG]]

 

1: 1 kb ladder marker

2: adx Lentivirus 

 

*1 uL adx Lentivirus
*1 uL EcoRI (fast digestion)
*1 uL BamHI (fast digestion)
*1.5 uL 10x fast digestion buffer
*10.5 uL water

 

====== ========= ======

8/11/11

Digest with BamHI + XhoI

*5 uL DNA
*0.3 uL BamHI
*0.3 uL XhoI
*1.5 uL 10x buffer (fast digestion)
*7.9 uL water

Total: 15 uL

[[Image:Multiple digestions2 IFP 2011 8 11.JPG]]

Lane 1: 1 kb ladder 

Lane 2: IFP 1, pET 28b

Lane 3: IFP 3, pET 28b

Lane 4: Amp pAAV-IFP 254-1

Lane 5: Amp pAAV-IFP 254-4

 

Notes:

*IFP 3 pET 28b still shows good insert
*Ran gel too long maybe

 

====== ============== ======

8/12/11

Digest with BamHI + XhoI

Lanes 2-8 + 10-13:

*5 uL DNA
*1.5 uL 10x buffer (fast digestion)
*0.5 uL BamHI
*0.5 uL XhoI
*7.5 uL water

'''Total''': 15 uL

Lane 14:

*10 uL DNA
*3 uL 10x buffer (fast digestion)
*1 uL BamHI
*1 uL XhoI
*15 uL water

'''Total''': 30 uL

[[Image:Multiple digestions3 2011 8 12.JPG]]

 

1: 1 kb ladder marker

2: IFP-3 pET28b

3: mNeptune-1 pET 286

4: mNeptune-2 pET 286

5: mNeptune-3 pET 286

6: sfGFP2 pET 286

7: Taq RFP-1

8: Taq RFP-2

9: 1 kb ladder marker

10: EGFP

11: Amp pAAV-IFP 2 (Mindy)

12: Amp pAAV-IFP 3 (Mindy)

13: Amp pAAV-IFP 5 (Mindy)

14: pAAV-CFP 4 

Notes:

[[Category:Cloning]]

File:Multiple digestions3 2011 8 12.JPG

2011-08-12T17:03:22Z

Hylei:

File:0811-pka.JPG

2011-08-11T19:10:38Z

Hylei:

File:Multiple digestions2 IFP 2011 8 11.JPG

2011-08-11T16:27:17Z

Hylei:

284 pAAV-CMV-mkate2

2011-08-10T19:37:53Z

Hylei:

== '''SubCloning of CFP from pet28b-cfp to the pAAV-MCS (254)''' ==

'''Purpose:''' SubCloning of CFP from pet28b-cfp to the pAAV-MCS (254).

'''Date: '''2011-8-3 to 2011-8-10

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Robert, Mindy, Yolanda 

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-4

Digest  (clone #) with 

Digest  (clone #) with 

cut out insert and vector, ligate and transform 

=== Colony Screening ===

Date: 2011-8-10 

Make miniprep and digest with BamH1 + Xho1 

[[Image:PAAV-mkate2_2011_8_10.jpg]] 

 Lane 1: 1 kb ladder 

 Lanes 2-6: pAAV-mkate2

== '''Result intepretation/Summary''' ==

*pAAV-mkate2 clones 

== '''Conclusion''' ==

Restriction digestion 

Shows  

[[Category:Cloning]]

File:PAAV-mkate2 2011 8 10.jpg

2011-08-10T19:36:46Z

Hylei:

281 pAAV-CMV-BFP

2011-08-10T19:30:35Z

Hylei:

== '''SubCloning of CFP from pet28b-cfp to the pAAV-MCS (254)''' ==

'''Purpose:''' SubCloning of CFP from pet28b-cfp to the pAAV-MCS (254).

'''Date: '''2011-8-3 to 2011-8-10

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Robert, Mindy, Yolanda 

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-4

Digest  (clone #) with 

Digest  (clone #) with 

cut out insert and vector, ligate and transform 

=== Colony Screening ===

Date: 2011-8-10 

Make miniprep and digest with BamH1 + Xho1 

[[Image:PAAV-BFP 2011 8 10.jpg]] 

 Lane 1: 1 kb ladder 

 Lanes 2-6: pAAV-BFP

== '''Result intepretation/Summary''' ==

*pAAV BFP clones 

== '''Conclusion''' ==

Restriction digestion 

Shows  

[[Category:Cloning]]

282 pAAV-CMV-CFP

2011-08-10T19:28:22Z

Hylei:

== '''SubCloning of CFP from pet28b-cfp to the pAAV-MCS (254)''' ==

'''Purpose:''' SubCloning of CFP from pet28b-cfp to the pAAV-MCS (254).

'''Date: '''2011-8-3 to 2011-8-10

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Robert, Mindy, Yolanda 

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-4

Digest  (clone #) with 

Digest  (clone #) with 

cut out insert and vector, ligate and transform 

=== Colony Screening ===

Date: 2011-8-10 

Make miniprep and digest with BamH1 + Xho1 

[[Image:PAAV-CFP 2011 8 10.jpg]] 

Lanes 1-4 + 6: pAAV CFP 

 Lane 5: 1 kb ladder

== '''Result intepretation/Summary''' ==

*pAAV CFP clones 

== '''Conclusion''' ==

Restriction digestion 

Shows  

[[Category:Cloning]]

File:PAAV-BFP 2011 8 10.jpg

2011-08-10T19:27:30Z

Hylei:

File:PAAV-CFP 2011 8 10.jpg

2011-08-10T19:23:31Z

Hylei:

File:Multiple digestions 2011 8 10.JPG

2011-08-10T19:00:27Z

Hylei:

File:IMG 1253.JPG

2011-08-10T18:47:48Z

Hylei:

File:0810 254 bamhi.JPG

2011-08-10T18:41:03Z

Hylei:

File:0810 301 pka.JPG

2011-08-10T18:40:39Z

Hylei:

306 pAAV-EF1-MCS

2011-08-08T20:36:27Z

Hylei: Created page with "== '''Cloning of EF to pAAV-CMV-MCS''' == '''Purpose:''' Cloning of EF to pAAV-CMV-MCS. '''Date: '''2011-8-8 '''Notebook:''' '''Page:''' '''Clone ID:''' '''Experimenter..."

== '''Cloning of EF to pAAV-CMV-MCS''' ==

'''Purpose:''' Cloning of EF to pAAV-CMV-MCS.

'''Date: '''2011-8-8

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Haiyan

== '''Results''' ==

=== Subcloning ===

Date: 2011-6-8

=== Colony Screening ===

Date: 2011-8-8 

Make miniprep and digest with Mlui+ecori 

[[Image:0808_295_306_0808.JPG]] 

Lane 1: marker 

Lane 2-5: 295_pAAV-Syn-MCS, Mlui+ecori 

Lane 6-8: 306_pAAV-EF-MCS, Mlui+ecori 

Looks 295 no positive clone, 306 looks have insert, need to do pcr additional confirm. 

== '''Result intepretation/Summary''' ==

*PKAalpha 3+4 has one internal Xho1 site. GFP-Puro can be cut out with Xho1 + Mlu1. So Lane 1 has correct number of bands.
*PKA alpha 3+4 with CMV promoter can be cut out with Nde1+ BamH1. Lane 5 has correct number of bands.
*lane 6 maybe good (incomplete digestion)
*Sequencing Result: 

== '''Conclusion''' ==

Restriction digestion 

shows  pLentiGP clone #1 may be good, 

pLVGP-PKAalpha 3+4 is good 

=== ===

[[User:Paul.xu|Paul.xu]] 08:23, 15 June 2011 (EST) 

[[Category:Cloning]]

PlentiGP-App-303

2011-08-08T20:18:44Z

Hylei:

== '''Cloning of App to pLentiGP''' ==

'''Purpose:''' Cloning of App to pLentiGP

'''Date: '''2011/08/5 to 2011/8/7

'''Notebook:'''

'''Page:'''

'''Clone ID: '''303

'''Experimenters:''' Paul

== '''Results''' ==

=== PCR ===

Date: 2011-8-05

Condition: 

PCR was run by Haiyan 

[[Image:App PCR amplification 2 2011 8 5.jpg]] 

cut out band as shown above, gel purified, elute with 20 ul water. 

=== Digestion and Gel Purification ===

Date: 2011-8-5 

Digested purified DNA and vector plasmid pLentiGP (219) with 0.5 ul BamH1 + 0.5 ul Nhe1 

run 1% gel 

[[Image:App gel purification after digestion 2011 8 7.jpg]] 

cut out lane 1 and 2 bands (APP) and vector (lane 3). 

lane 4 is 1 kb ladder 

mix gel slice, add 0.8 ml QG buffer, purified using qiagen spin column, elute with 20 ul water. 

add 2.5 ul ligation buffer, 0.5 ul ligase, ligate at 25 oc for 2 hours. 

transform STBL3 

plate on LB/amp plate o/n at 37oC. 

 

=== Colony Screening ===

Date: 2011-8-6 

pick up 7 colonies, grow in 5 ml LB/amp O/N at 37 oC 

Date: 2011-8-7 

Make miniprep elute with 50 ul EB, digest 3 ul DNA with 0.25 ul BamH1 + Nhe1, 1.5 ul 10X fastdigest buffer in 15 ul final vol, 37 oC for 45 min. 

Run 1% gel 

 [[Image:App colony screening restriction digestion 2 2011 8 7.jpg]] 

Lane 1 & 12, 1 kb ladder 

Lane 2 to 8, pLentiGP-app digested with BamH1 + Nhe1 

Lane 9 pLentiPlus digested with Nhe1+ Nde1 

Lane 10 pLentiPlus digested with BamH1+ Nde1 

Lane 11 pLentiPlus digested with Xho1+ Nde1 

Looks like lane 2, 5, 6, 7, 8 (clone 1,  4, 5, 6, 7) are good, discard colonies 2 and 3 (lane 3 and 4). 

vector pLentiPlus is also good.

=== Additional PCR Screening to test the above app colonies ===

Date: 2011-8-8 

using cmv-f/app-r primer set to check the above clone 1,  4, 5, 6, 7 

Run 1% gel 

 [[Image:0808_app_pcr_0808.JPG]] 

Lane 1 ; 1 kb ladder 

Lane 2 to 6, clone 1,  4, 5, 6, 7 pcr amplify 

Looks like lane 2-6 have amplified bands (clone 1,  4, 5, 6, 7) 
seq clony #5 (lane 3).

Haiyan, 2011-08-08 

== '''Result intepretation/Summary''' ==

'''Digestion''': Clone 1, 4, 5, 6, 7 may be  good. 

'''Sequencing''':send plasmid from clony #5 for sequencing 

 

== '''Conclusion''' ==

 

= The following experiments were done by Haiyan =

-======================

== '''colonies screening for plentigp-app-303''' ==

'''Purpose:''' colonies screening for plentigp-app-302 and pcr amplifying for the 295 (syn) and 306 (ef).

'''Date: '''2011/08/01

'''Notebook:'''

'''Page:'''

'''Clone ID:'''

'''Experimenters:''' Haiyan,

== '''Results''' ==

=== Subcloning ===

Date: 2011-8-01

Digest pAAV-MCS (clone #254) with MLU1+ECORI 

Digest 295 AND 306 PCR AMPLIFY (clone #) with MLU1+ECORI [[Image:0802-ef1.JPG]] 295 got two digest bands, something wrong, not continue. for the 306, too weak bands, not seen. just ligate the direct cut PCR product to see what is going on. 

=== Colony Screening for app ===

Date: 2011-8-1 

Make miniprep and digest with Ecori+agei 

[[Image:0801-app.JPG]] 

Lane 1: Marker Lane 2: 295 PCR 10UL Lane 3:306 PCR 10UL Lane 4-9, pLVGP-app, Ecori+agei lane 5 and 8 should be positive clone. 

 

Date: 2011-8-3 

[[Image:0803-app.JPG]] 

Lane 1: Marker Lane 2-8: pLentigp-app, Ecori+agei lane 3, 6 and 8 should be positive clone. lane 9, plenti-pka-gluc, nhei+xhoi; should be positive clone. 

 

Date: 2011-8-5 

[[Image:0806-app1.JPG]] 

Lane 1: Marker Lane 2, app amplify,305 (original app DNA )app-f/app-r primer set, pfusion enzyme, 10ul run gel (50ul volume); Lane 3&4, pka 1 and 2 amplify, nhei-f1/xhoi1 and nhei-f2/xhoi2 primer set, pfusion enzyme, 10ul run gel (50ul volume); Lane 5-10, colonies amplify using app-f/app-r primer set Lane 11, 305 (original app DNA )app-f/app-r primer set ;

[[Image:0806-app2.JPG]] Lane 1-3 overlap with last fig 9-11 ; lane 3-8, app plasmid as template; names 305, app 1-5; , regular taq could not get strong pcr amplify bands for app,app-f/app-r primer set lane 4, app1 DNA lane 5, app2 lane 6, app3 lane 7, app4 lane 8, app5 lane 9, plentiGP ECORI+AgeI cut lane 10, app 1 ECORI+AgeI cut, same plasmid with lane 4 

[[Image:0806-app3.JPG]] lane 1, marker lane 2, app 2 ECORI+AgeI cut, same plasmid with last fig lane 5; lane 3, app 3 ECORI+AgeI cut, same plasmid with last fig lane 6; lane 4, app 4 ECORI+AgeI cut, same plasmid with last fig lane 7; lane 5, app 5 ECORI+AgeI cut, same plasmid with last fig lane 8; lane 6,plentiGP bamhi+nhei cut lane 7, app 1 bamhi+nhei cut lane 8, app 2 bamhi+nhei cut lane 9, app 3 bamhi+nhei cut lane 10, app 4 bamhi+nhei cut lane 11, app 5 bamhi+nhei cut 

conclusions: seems plentigp DNA already degraded in 4 degree; it seems app 2 and app3 are positive clones, colonies screening from app 2 transform plates; app 2 is yesterday's sequence clone, 483 ng/ul, ratio is 1.83 

 

 

== '''Result intepretation/Summary''' ==

*PKAalpha 3+4 has one internal Xho1 site. GFP-Puro can be cut out with Xho1 + Mlu1. So Lane 1 has correct number of bands.
*PKA alpha 3+4 with CMV promoter can be cut out with Nde1+ BamH1. Lane 5 has correct number of bands.
*lane 6 maybe good (incomplete digestion)
*Sequencing Result: 

== '''Conclusion''' ==

Restriction digestion 

shows  pLentiGP clone #1 may be good, 

pLVGP-PKAalpha 3+4 is good 

=== ===

[[Category:Cloning]]

File:0808 app pcr 0808.JPG

2011-08-08T20:10:16Z

Hylei:

File:0808 gluc vector 0808.JPG

2011-08-08T20:10:01Z

Hylei:

File:0808 295 306 0808.JPG

2011-08-08T20:09:44Z

Hylei:

Plenti-app-303

2011-08-07T21:05:29Z

Hylei: moved Plenti-app-303 to PlentiGP-App-303

#REDIRECT [[PlentiGP-App-303]]

File:App colony screening restriction digestion 2 2011 8 7.jpg

2011-08-07T20:40:22Z

Hylei: uploaded a new version of "File:App colony screening restriction digestion 2 2011 8 7.jpg"

File:App PCR amplification 2 2011 8 5.jpg

2011-08-07T20:19:51Z

Hylei: uploaded a new version of "File:App PCR amplification 2 2011 8 5.jpg"

File:App colony screening restriction digestion 2011 8 7.jpg

2011-08-07T20:14:16Z

Hylei: uploaded a new version of "File:App colony screening restriction digestion 2011 8 7.jpg"

File:App gel purification after digestion 2011 8 7.jpg

2011-08-07T20:13:47Z

Hylei: uploaded a new version of "File:App gel purification after digestion 2011 8 7.jpg"

File:App PCR amplification 2011 8 5.jpg

2011-08-07T20:10:19Z

Hylei: uploaded a new version of "File:App PCR amplification 2011 8 5.jpg"