ELN - User contributions [en]

File:1346 protein FPLC 9 26 2012.jpg

2012-09-26T18:25:21Z

Xiuli.huang: uploaded a new version of "File:1346 protein FPLC 9 26 2012.jpg"

1377 pCMV5-Fc-(3c)-NPR1-Cyto-WPRE-oriP

2012-09-25T15:07:43Z

Xiuli.huang:

== '''Cloning of pCMV5-Fc-(3c)-NPR1-Cyto-WPRE-oriP''' ==

'''Purpose:''' subcloning of gene NPR1-cyto from 1284 pCMV5-Fc(3c)-NPR1-Cyto into 1369 pCMV5-Fc-(3c)-TagRFP-WPRE-oriP with NheI and NotI 

 '''Date:&nbsp;''' 2012-09-20

 '''Notebook:&amp;nbsp;'''

'''Page:'''

'''Clone ID: 1377'''

'''Experimenters: Xiuli'''

'''insert size: ~ 1647bp''' 

== '''Results''' ==

 

Cloning

[[Image:9202012-1377-1381.jpg]] 

09-19-2012

A.Restriction enzyme digestion: plasmid 1284,1276 1264, 1269, 1263 and 1396 cut with NheI and NotI. 

B. Gel purification and elute with 15 ul H2O

c Ligation: 2xLigation buffer (12ul) +12 ul elution from above +0,5 ul T7 ligase. Incubate at RT for 1 hour 

D. Transformation.

9/22/2012

make miniprep, digest with Nhe1 + Not1

[[Image:1377 78 79 80 81 2012 9 22.jpg]]

[[Image:1377 78 79 80 81 2012 9 22 2.jpg]]

9/24/2012

Select 1377-2, 1378-1, 1379-2, 1380-2, 1381-1 to make maxiprep using Qiagen maxiprep kit. 1381, 1392  using invitrogen maxiprep  kit

[[Image:1377-1381 maxi cut .jpg]][[Image:1377-1381 maxi-cut.jpg]]

1377-1378-1379-1380-1380-1381 Plasmid Maxiprep 

 

Clones for maxiprep

{| width="330" height="125" border="1" cellspacing="1" cellpadding="1"
|-
| Clone ID 
| Parent 
| Clone Name 
|
Expected Size

(bp) 

| Actual Size on Gel (Kb) 
| Clone Identity 
| DNA conc 
| OD260/280 
| RNA 
|-
| 1377-1 
| 1284 
| 
| 1647 
| 2.5 
| 
| 
| 
| 
|-
| 1378-2 
| 1276 
| 
| 1322 
| 1.6 
| 
| 
| 
| 
|-
| 1379-2 
| 1264 
| 
| 3205 
| 4 
| 
| 
| 
| 
|-
| 1380-2 
| 1269 
| 
| 2169 
| 3 
| 
| 
| 
| 
|-
| 1381-1 
| 1263 
| 
| 1586 
| 2.5 
| 
| 
| 
| 
|}

1381 and 1392 using Invitrogen maxi prep kit have too much RNA. After treating  sample 1381 and 1392 with 0.5 ul RNAse (Qiagen) at 37oC for 2-3 hours, precipitate DNA with isoprapanol.

[[Category:Cloning]]

1381 pCMV5-Fc-(3c)-RIPK3-WPRE-oriP

2012-09-25T14:59:05Z

Xiuli.huang:

== '''1381Cloning of  pCMV5-Fc-(3c)-RIPK3-WPRE-oriP''' ==

'''Purpose:''' subcloning of gene RIPK3 from 1263 pCMV5-Fc(3c)-RIPK3 into 1369 pCMV5-Fc-(3c)-TagRFP-WPRE-oriP with NheI and NotI

'''Date:''' 2012-09-20

'''Notebook:4880'''

'''Clone ID: 1381'''

'''Experimenters: Xiuli'''

== '''Results''' ==

Cloning

[[Image:9202012-1377-1381.jpg]] 

09-20-2012

A.Restriction enzyme digestion: plasmid 1284,1276 1264, 1269, 1263 and 1396 cut with NheI and NotI. 

B. Gel purification and elute with 15 ul H2O

c Ligation: 2xLigation buffer (12ul) +12 ul elution from above +0,5 ul T7 ligase. Incubate at RT for 1 hour 

D. Transformation. 

9/22/2012

make miniprep, digest with Nhe1 + Not1

[[Image:1377 78 79 80 81 2012 9 22.jpg]]

[[Image:1377 78 79 80 81 2012 9 22 2.jpg]]

9/24/2012

Select 1377-2, 1378-1, 1379-2, 1380-2, 1381-1 to make maxiprep using Qiagen maxiprep kit. 1381, 1392  using invitrogen maxiprep  kit

[[Image:1377-1381 maxi cut .jpg]][[Image:1377-1381 maxi-cut.jpg]]

1381 and 1392 using Invitrogen maxi prep kit have too much RNA. After treating  sample 1381 and 1392 with 0.5 ul RNAse (Qiagen) at 37oC for 2-3 hours, precipitate DNA with isoprapanol.

[[Category:Cloning]]

1380 pCMV5-Fc-(3c)-GNE-WPRE-oriP

2012-09-25T14:58:08Z

Xiuli.huang:

== '''1380 Cloning of pCMV5-Fc-(3c)-GNE-WPRE-oriP''' ==

'''Purpose:''' subcloning of gene GNE from 1269 pCMV5-Fc(3c)-GNE into 1369 pCMV5-Fc-(3c)-TagRFP-WPRE-oriP with NheI and NotI

'''Date:''' 2012-09-20

'''Notebook:'''

'''Clone ID: 1380'''

'''Experimenters: Xiuli'''

== '''Results''' ==

Cloning

[[Image:9202012-1377-1381.jpg]] 

09-20-2012

A.Restriction enzyme digestion: plasmid 1284,1276 1264, 1269, 1263 and 1396 cut with NheI and NotI. 

B. Gel purification and elute with 15 ul H2O

c Ligation: 2xLigation buffer (12ul) +12 ul elution from above +0,5 ul T7 ligase. Incubate at RT for 1 hour 

D. Transformation. 9/22/2012

make miniprep, digest with Nhe1 + Not1

[[Image:1377 78 79 80 81 2012 9 22.jpg]]

[[Image:1377 78 79 80 81 2012 9 22 2.jpg]]

9/24/2012

Select 1377-2, 1378-1, 1379-2, 1380-2, 1381-1 to make maxiprep using Qiagen maxiprep kit. 1381, 1392  using invitrogen maxiprep  kit

[[Image:1377-1381 maxi cut .jpg]][[Image:1377-1381 maxi-cut.jpg]]

1381 and 1392 using Invitrogen maxi prep kit have too much RNA. After treating  sample 1381 and 1392 with 0.5 ul RNAse (Qiagen) at 37oC for 2-3 hours, precipitate DNA with isoprapanol.

[[Category:Cloning]]

1379 pCMV5-Fc-(3c)-NPR1-WPRE-oriP

2012-09-25T14:56:55Z

Xiuli.huang:

== '''1379 Cloning of pCMV5-Fc-(3c)-NPR1-Cyto-WPRE-oriP''' ==

'''Purpose:''' subcloning of gene NPR1 from 1264 pCMV5-Fc(3c)-NPR1 into 1369 pCMV5-Fc-(3c)-TagRFP-WPRE-oriP with NheI and NotI

'''Date:&amp;nbsp;''' 2012-09-20

'''Notebook:'''

'''Clone ID: 1379'''

'''Experimenters: Xiuli'''

== '''Results''' ==

Cloning

[[Image:9202012-1377-1381.jpg]] 

09-20-2012

A.Restriction enzyme digestion: plasmid 1284,1276 1264, 1269, 1263 and 1396 cut with NheI and NotI. 

B. Gel purification and elute with 15 ul H2O

c Ligation: 2xLigation buffer (12ul) +12 ul elution from above +0,5 ul T7 ligase. Incubate at RT for 1 hour 

D. Transformation. 
9/22/2012

make miniprep, digest with Nhe1 + Not1

[[Image:1377 78 79 80 81 2012 9 22.jpg]]

[[Image:1377 78 79 80 81 2012 9 22 2.jpg]]

9/24/2012

Select 1377-2, 1378-1, 1379-2, 1380-2, 1381-1 to make maxiprep using Qiagen maxiprep kit. 1381, 1392  using invitrogen maxiprep  kit

[[Image:1377-1381 maxi cut .jpg]][[Image:1377-1381 maxi-cut.jpg]]

1381 and 1392 using Invitrogen maxi prep kit have too much RNA. After treating  sample 1381 and 1392 with 0.5 ul RNAse (Qiagen) at 37oC for 2-3 hours, precipitate DNA with isoprapanol.

[[Category:Cloning]]

1378 pCMV5-Fc-(3c)-NPR1-ECD-WPRE-oriP

2012-09-25T14:55:55Z

Xiuli.huang:

== '''1378  Cloning of pCMV5-Fc-(3c)-NPR1-ECD-WPRE-oriP''' ==

'''Purpose:''' subcloning of gene NPR1-ECD from 1276 pCMV5-Fc(3c)-NPR1-ECD into 1369 pCMV5-Fc-(3c)-TagRFP-WPRE-oriP with NheI and NotI

'''Date:;''' 2012-09-20

'''Notebook:'''

'''Page:'''

'''Clone ID: 1378'''

'''Experimenters: Xiuli'''

== '''Results''' ==

Cloning

[[Image:9202012-1377-1381.jpg]] 

09-20-2012

A.Restriction enzyme digestion: plasmid 1284,1276 1264, 1269, 1263 and 1396 cut with NheI and NotI. 

B. Gel purification and elute with 15 ul H2O

c Ligation: 2xLigation buffer (12ul) +12 ul elution from above +0,5 ul T7 ligase. Incubate at RT for 1 hour 

D. Transformation. 
9/22/2012

make miniprep, digest with Nhe1 + Not1

[[Image:1377_78_79_80_81_2012_9_22.jpg]]
9/22/2012

make miniprep, digest with Nhe1 + Not1

[[Image:1377 78 79 80 81 2012 9 22.jpg]]

[[Image:1377 78 79 80 81 2012 9 22 2.jpg]]

9/24/2012

Select 1377-2, 1378-1, 1379-2, 1380-2, 1381-1 to make maxiprep using Qiagen maxiprep kit. 1381, 1392  using invitrogen maxiprep  kit

[[Image:1377-1381 maxi cut .jpg]][[Image:1377-1381 maxi-cut.jpg]]

1381 and 1392 using Invitrogen maxi prep kit have too much RNA. After treating  sample 1381 and 1392 with 0.5 ul RNAse (Qiagen) at 37oC for 2-3 hours, precipitate DNA with isoprapanol.

[[Category:Cloning]]

File:1377-1381 maxi-cut.jpg

2012-09-25T14:42:12Z

Xiuli.huang:

File:1377-1381 maxi cut .jpg

2012-09-25T14:40:41Z

Xiuli.huang:

File:9202012-1377-1381.jpg

2012-09-20T19:21:12Z

Xiuli.huang: uploaded a new version of "File:9202012-1377-1381.jpg"

1378

2012-09-20T19:13:02Z

Xiuli.huang: Blanked the page

PCMV5-Fc-(3c)-NPR1-Cyto-WPRE-oriP

2012-09-20T17:59:38Z

Xiuli.huang:

== '''Cloning of 1377pCMV5-Fc-(3c)-NPR1-Cyto-WPRE-oriP''' ==

'''Purpose:''' subcloning of 3C into pDB.His.MBP(V14)

 '''Date:&nbsp;''' 2012-09-18 

 '''Notebook:&amp;nbsp;'''

'''Page:'''

'''Clone ID: 1375'''

'''Experimenters: Xiuli'''

== '''Results''' ==

Cloning

[[Image:PDB.HIS 3C.jpg]]

09-19-2012 A.Restriction enzyme digestion: Vector V14 pDB.His.MBP and 1197 pDB.His.GST.3C with NdeI and XhoI, B.Gel purification (elute with 15 ul H2O), and ligation with T7 ligase at RT for2 hs (total volume in 30ul) C Transformation: DH5a + 20 ul ligation Re. 

[[Category:Cloning]]

File:PDB.HIS 3C.jpg

2012-09-19T19:31:47Z

Xiuli.huang:

1197 pDB.His.GST-3C

2012-09-19T18:32:00Z

Xiuli.huang:

== '''Cloning of 1197 pDB.His.GST-3C''' ==

'''Purpose:''' subcloning of 3C into pDB.His.MBP 

'''Date: '''2012-09-18

'''Notebook: '''

'''Page:'''

'''Clone ID: 1373'''

'''Experimenters: '''xiuli

== '''Results''' ==

=== Cloning ===

Date: 2012-5-29 

[[Image:1197 gene synthesis 5 29 2012.JPG]] 

Gene synthesis by PCR, cut out band, purify and digest with Nde1 + Xho1, ligate with  Nde1 + Xho1 digested pDB.His.GST 433 

[[Image:1197 Digestion 5 29 2012.jpg]] Vector (2) PCR product (1) digested with Nde1 and Xho1. Cut out, gel purify, elude with water. Date: May 31, 2012 

 

[[Image:1197 PCR Screening 05312012 1.JPG]]

Grew bacteria from lanes 5, 6, 8, 9, 11 and 12

Date 6/1/2012: Bacteria did not grow in 5 of the tubes, only grew from Lane 8

Digested sample 8 with Nde1 and Xho1

[[Image:1197 Digest.JPG]]

Submitted sample for sequencing

Date: 06/04/2012 Sequencing came back bad (contaminated) picked up new colonies and grew them in media (7 samples)

06/05/2012: Samples did not grow in the media, started experiment over again

Made PCR product using PHUSION enzyme:

[[Image:1197 PCR Product.JPG]]

Cut out bands, purified, eluted with 20 uL water

[[Image:1197 Digestion.JPG]]

Digested DNA PCR product and pDB.His.GST vector with Nde1 + Xho1

Cut out bands, purified, ligated, transformed with DH5 alpha cells, grow on KAN plates 

6/6/2012: No growth on plates, may have cut out incorrect band yesterday

Redid gene synthesis today

[[Image:1197 Amp.JPG]]

No bands present, redo AGAIN, maybe it is the FHUSION enzyme?

 

Redid amplication with KAPA enzyme, cut out band for purification and digestion

[[Image:1197 amp 2.JPG]]

Digested DNA PCR product and pDB.His.GST vector with Nde1 + Xho1

Cut out bands, purified, ligated, transformed with DH5 alpha cells, grow on KAN plates 

[[Image:06062012 Digestion.JPG]]

06/07/2012: Again, no growth on plates.

Synthesized PCR product again, unsuccessful. 

[[Image:1197 0607 AMP.JPG]]

successful amplifacation of gene, cut out top band, purified DNA, digested DNA and vector for digestion 

[[Image:1197 0607 amp 2.JPG]] 

Digested DNA PCR product and pDB.His.GST vector with Nde1 + Xho1

[[Image:1197 0607 Digestion.JPG]]

Cut out bands, purified, ligated, transformed with DH5 alpha cells, grow on KAN plates 

Date: June 14, 2012

Sequencing was all bad, restarted from the beginning. Amplifaction of template

[[Image:0614 amp 2.JPG]]

Let gel run too long by accident, but going to cut out the bottom the gel for purifacation and digestion (see lane one) 

[[Image:1197 Digestion 0619.JPG]] 

Digested 1197 with enzymes, incorrect band size (lanes 1 - 4)

Reamplified 1197 with PHUSION, a lot of smearing (see lane 7) 

Date: June 18, 2012

[[Image:0618 Digest.JPG]]

Reamplifed gene, see lans 5 an 6. Very blurry

 Date: June 19, 2012

Attempted to synthesize DNA again, a lot of smearing

[[Image:1197 0619.JPG]]

 

{| cellspacing="1" cellpadding="1" border="1" style="width: 200px; height: 88px;"
|-
|
Lane

| Amount of Template
|-
| 1
| 0.25 uL 
|-
| 2
| 0.50 uL
|-
| 3
| 1.0 uL
|}

Date: June 20, 2012 

[[Image:1197 0620amp.JPG]]

Reamplifed 1197 (see lanes 8 and 9), purified and digested with Nde1 and Xho1

[[Image:1197 0620 Digestion.JPG]]

Digestion of DNA very blurry

Redid amplifaction: 

[[Image:1197 smear.JPG]]

Left: KAPA, Right: PHUSION

Still very blurry, used 0.5 uL of template NO CLEAR BAND

Date: June 21, 2012 

Reamplified 1197 with KAPA enzyme (40 seconds extension, 20 cycles and 0.5 uL of template) 

[[Image:1197 kapa amp.JPG]] 

Successful amplifaction, cut out the top band for digestion with v48 with Nde1 and Xho1 

[[Image:1197 digestion 0621.JPG]]

Succesful digestion, cut out circled bands in lane 7 and 8

Purified DNA and ligated

Date: June 22, 2012 

Tranformed with Top 10 cells and plated on KAN resistant plates (to grow over the weekend) - Paul said sequencing for this may be bad because I used 0.5 uL of KAPA enzyme, reamplifed with only 0.25 uL of KAPA enzyme 

[[Image:0622 Amp.JPG]] 

Cut out band in lane 4 (expected size = 600 bp), placed in tube in gel, will purify and digest on Monday 

Date: June 25. 2012

[[Image:0625 Digestion.JPG]]

Digested 1197 and vector 433 (v48) with Ndel and Xho1, cut out bands and purified, ligated

=== Colony Screening ===

[[Image:0608 PCR Screening.JPG]]

Only sample 2 positive (lane 9) grew in KAN media overnight

[[Image:1197 1155 Digestion.JPG]]

Did MiniPrep and digested plasmid to check for inserts, submitted sample 2 (lane 2) for sequencing\

Date: June 26, 2012

[[Image:0626 Screening.JPG]]

All positive clones, grew samples 1-6 (lanes 1-6) in media over night

Date: June 27, 2012

Digested Miniprep with enzymes, check if insert is still present

[[Image:0627 Screening.JPG]]

All clones positive (expected size = ~600 bp)

Submitted sample 2 (lane 2) for sequencing

== '''Result intepretation/Summary''' ==

 

== '''Conclusion''' ==

 

[[Category:Cloning]]

1353-1305-1369 transfection on 0912-2012

2012-09-18T16:44:55Z

Xiuli.huang:

{| width="434" cellspacing="1" cellpadding="1" border="1"
|-
| No. 
| ID 
| Plasmid Name                               
| conc.(ug/ul)
| TR (transfection reagent 
| Color 
|-
| 1 
| 1353 
| pCMV5-Fc(3C)-RFP-WPRE 
| 2.0
| PEI 
| no 
|-
| 2 
| 1305 
| pCMV5-Fc(3C)-TagRFP 
| 1.0
| PEI 
| no 
|-
| 3 
| 1369 
| pCMV5-Fc-(3c)-TagRFP-WPRE-oriP 
| 2.8
| PEI 
| no 
|-
| 4 
| 174 
| pLVXPlus2-IRES-mCherry 
| 0.58
| PEI 
|  a few 
|-
| 5 
| 529 
| pLVX-mIL10-IRES-EGFP 
| 2.8
| PEI 
| weak 
|}

12 well plate transfection: use 1,2,3 ug DNA plasmid and 3 ul PEI TR . There is no RFP in clone 1353,1305 and 1369 . For clone 529, 2ug od DNA show weak GFP but not in 1ug and 3 ug at 16 hours. (transfected on 4:00PM and observed on 9:00AM next day) 

Conclutsion: No show RFP expression. Compare to previous transfection results, 529 expression not as expected. maybe PEI reagent are not very efficient.

 

 

 

[[Category:Cloning]] [[Category:QC]]

1353-1305-1369 transfection on 0913-2012

2012-09-18T16:28:50Z

Xiuli.huang:

{| width="434" cellspacing="1" cellpadding="1" border="1"
|-
| No. 
| ID 
| Plasmid Name                               
| conc.(ug/ul)
| Lipofectanine 2000 
| Roche 
|-
| 1 
| 1353 
| pCMV5-Fc(3C)-RFP-WPRE 
| 2.0
|   very weak red at 24hs 
| no
|-
| 2 
| 1305 
| pCMV5-Fc(3C)-TagRFP 
| 1.0
| very weak red at 24hs 
| no 
|-
| 3 
| 1369 
| pCMV5-Fc-(3c)-TagRFP-WPRE-oriP 
| 2.8
| very weak red at 24hs 
| no 
|-
| 4 
| 174 
| pLVXPlus2-IRES-mCherry 
| 0.58
| red 
| less red 
|-
| 5 
| 529 
| pLVX-mIL10-IRES-EGFP 
| 2.8
| strong 
| less strong 
|}

12 well plate transfection (293F cells): use 2 ug DNA plasmid and 6 ul lipofectamine and Roche transfection reagents . There is no RFP in clone 1353,1305 and 1369 at 16 hs, and start to show RFP at 24 hours. Cells started to die becase of the toxicity of lipo2000, For clone 529 and 174, transfection efficiency as expected. 

Conclutsion: weak RFP expression with Lipofectamine 2000. 

 

 

 

[[Category:Cloning]] [[Category:QC]]

1353-1305-1369 transfection

2012-09-18T15:38:34Z

Xiuli.huang:

{| width="586" cellspacing="1" cellpadding="1" border="1"
|-
| No. 
| ID 
| Plasmid Name                               
| Conc.(ug/ul)
| DNA (1ug) 
| TR reagent 3ul
| dilution
| color
|-
| 1 
| 1353 
| pCMV5-EGFP-WPRE 
| 2.0
| 0.5 ul 
| PEI
| 50 ul DMEM
| x
|-
| 2 
| 1305 
| pCMV5-Fc(3C)-TagRFP 
| 1.0
| 1 ul 
| PEI
| 50 ul DMEM
| x
|-
| 3 
| 1369 
| pCMV5-Fc-(3c)-TagRFP-WPRE-oriP 
| 2.8
| 0.36 ul
| PEI
| 50 ul DMEM 
| x
|}

Talk:1353-1305-1369 transfection

2012-09-18T15:25:41Z

Xiuli.huang: Created page with "Did transfection after Maxiprep with Qiagen Hi-Speed column with 1L LB culture"

Did transfection after Maxiprep with Qiagen Hi-Speed column with 1L LB culture

Lentivirus-Production-293T

2012-09-12T13:10:42Z

Xiuli.huang:

1. 24 hours before transfection, split cells into  four 15cm plates/dishes for a confluency of ~80% the next day, add 25 ml of complete DMEM medium (10% FBS, with P/S).

 

2. Transfection

 '''For each plate:'''

In a 50 ml sterile tube, add '''180 ul''' GeneExpresso Max into '''600 ul''' serum-free  DMEM medium--->'''Mix A'''

 

In a 50 ml of sterile tube, add '''30 ug '''of lentivirus vector with GOI, then '''30 ug V+G''' packaging vector mix (V:G, <strike>1:2,</strike> or 1:1) to '''600 ul''' DMEM medium--->'''Mix B'''.

 

Mix by pipetting using a filtered tip.'''Transfer Mix A to Mix B,''' mix by pipetting. Incubate '''15-20 minutes''' at room temperature. Pipette transfer ~'''1.2 ml '''mix onto one plate.

'''4 plates:'''

720 ul GeneExpresso Max in 2.4 ml serum free DMEM

120 ug of lentivirus vector + 120 ug V+G packaging mix in 2.4 ml serum free DMEM.

 

3. '''Optional''' Replace medium '''48 hours''' after transfection (do not discard the medium, put the conditioned medium into clean 50 ml polypropylene tubes). Store conditioned medium in cold room. Use  medium containing '''2% serum '''and 6 μM sodium butyrate 

 

4. Collect supernatant'''2 and  4 days''' after transfection, store virus containing-medium in cold room. Add '''25 ml''' fresh complete medium.

or collect supernatant on '''day 3''' 

 

<strike>5. Collect supernatant '''6 days '''after transfection. Discard plates.</strike>

 

6. [[Lentivirus Concentration PEG|Combine supernatant and precipitate the virus using PEG]].

 

== Use psPAX2 (503)+ VSVG (505) ==

 

{| cellspacing="1" cellpadding="1" border="1" style="width: 436px; height: 155px;"
|-
| 
| 15cm dish
| 10cm dish
| 6 well
|-
| psPAX2 (packaging plasmid) 
| 15 ug
| 6 ug 
| 1 ug 
|-
| pVSVG (envelope plasmid)
| 7.5 ug 
| 3 ug 
| 0.5 ug 
|-
| pLVX or pLenti 
| 22.5 ug 
| 10 ug 
| 1.7 ug 
|-
| Total DNA 
| 45 
| 19 
| 3.2 
|}

  

 

[[Category:Protocols]]

File:TagGFP PCR 9 11 2012.jpg

2012-09-12T03:31:51Z

Xiuli.huang:

1368 pLVX-TX 05-HAwt-TagRFP

2012-09-11T23:53:11Z

Xiuli.huang:

== '''Cloning of 1368 pLVX-TX 05-HAwt-TagRFP''' ==

'''Purpose:''' fix pLVX-TX 05-HAwt-TagRFP TagRFP frameshift 

'''Date: '''9/7/2012 

'''Notebook: '''

'''Page:'''

'''Clone ID: '''1368

'''Experimenters: '''Yingying

== '''Results''' ==

=== Cloning ===

Date: 9/7/2012

PCR

[[Image:1368 1366 1348 1346 9 7 2012.jpg]] 

'''9/8/2012 Digestion for cloning''' 

'''Lane 2, 4, 6:''' TagGFP amplified with TagGFP-EcoR1-BamH1-F & TaqGFP-R3 using 110 pLVX-TagGFP as template as template 

'''Lane #9''': TagRFP amplified with TagRFP-EcoR1-BamH1-F gtattcgaattcGCGGCCGCggatccGTGTCTAAGGGCGAAGAGCTG ATG AGC GGG GGC GAGGAGCTGTTCGCCGGCATCG

TagRFP-Xba1-R (GCAAACTGGGGCACAAACTTAA TCTAGA CGATCAA) TTG ATC GTC TAG ATT AAG TTT GTG CCC CAG TTT GC 

'''Lane #10''': PCR product VP16 + EBNA1c has this configuration: EcoR1 ---VP16--BamH1--EBNA1c--Xho1 

'''Lane #12''': A/WSN/33 M15/88E amplified FluASeg-7-NdeI-F actagc CAT ATG CAC CAT CAT CAT CAT CAT agtcttctaaccgaggtc

FluASeg-7-Xho1-R (catcggtctcataggcaaatgCTCGAG atcaga) tctgatCTCGAGcatttgcctatgagaccgatg using 61 pHW2000-A/WSN/33 M15/88E as template 

[[Image:9 8 2012 digestion.jpg]]

{| cellspacing="1" cellpadding="1" border="1" style="width: 598px; height: 107px;"
|-
| 
| 1 
| 2 
| 3 
| 4 
| 5 
| 6 
| 7 
| 8 
| 9 
| 10 
| 11 
| 12 
| 13 
|-
| Plasmid ID 
| 1333 
| 
| 1334 
| 
| 1329 
| 
| 1330 
| 1329 
| 1368 
| 
| 254 
| 
| 1036 
|-
| Plasmid or DNA Name 
| 
| TagGFP 
| 
| TagGFP 
| 
| TagGFP 
| 
| 
| TagRFP 
| VP16 + EBNA1c 
| 
| A/WSN/33 M15/88E 
| 
|-
| Digestion 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| EcoR1+ Xba1 
| BamH1 + Xho1 
| BamH1 + Xho1 
| Nde1 + Xho1 
| Nde1 + Xho1 
|}

cut out bands as indicated, purify and ligate using T7 ligase + 10X T4 ligase buffer. 

transform DH5a

=== Colony Screening ===

Date: 

'''9/11/2012''' 

Clone 1366-1: TagGFP fix plasmid digestion, looks like ligation did not work with T7 ligase + T4 buffer. plasmid can be digested/linearied with EcoR1 and Xho1, but not BamH1

[[Image:9 11 2012 TagGFP fix.jpg]]

 

== '''Result intepretation/Summary''' ==

 

== '''Conclusion''' ==

 

[[Category:Cloning]]

File:9 11 2012 TagGFP fix.jpg

2012-09-11T23:44:30Z

Xiuli.huang: