Paul.xu at 19:44, 17 April 2012

2012-04-17T19:44:16Z

New page

Cloning of pHis-GST-TEV (1030) Purpose: to clone pHis-GST-TEV Date: 2012-3-26 to 2012-4-11 Notebook: Xiaojing Wang Page: 004206 Clone ID: 1030 Experimenters: Xiaojing Wang Results 

[[Image:1030 PCR 3.27.2012.JPG]] 

The bands show PCR product of 1030, 

TEV-Nde1-F atcatg CATATG GGAGAAAGCTTGTTTAAGGG 

TEV-Xho1-R (cagttaaggaagcgactcaatag ctcgag actgac)

gtcagtctcgagctattgagtcgcttccttaactg

 

Digest result: 

[[Image:1030 P V digest 3.28.2012.JPG]] 

digest PCR product and vector with Nde1+Xho1, run gel

the left bands show 1030 insert, the right bands show 1029 vector

gel purify, ligate, transform Top10,K+

Colony Screening 

[[Image:1030 digest 3.30.2012.JPG]] 

1032-1,-2,-3,-4 may be correct.

Select 1032-4 to sequence. 

 

Wrong design should not use TEV-Nde1-F 

Results 

[[Image:1030 2 PCR 4.2.2012.JPG]] 

The bands show PCR product of 1030,

Use primer: TEV-EcoR1-F TATCG GAA TTC GGA GAA AGC TTG TTT AAG G E F G E S L F K TEV-Xho1-R Xho1 (cagttaaggaagcgactcaatag ctcgag actgac)

gtcagtctcgagctattgagtcgcttccttaactg

 

Digest result: 

[[Image:1030 pv digest 4.5.2012.JPG]] 

digest PCR product and vector with EcoR1+Xho1, run gel

the left bands show 1030 insert, the right bands show 1029 vector

gel purify, ligate, transform Top10,K+

Colony Screening 

Select 10 clones to do PCR Screening 

[[Image:1030 PCR Screening 4.6.2012.JPG]] 

Clone 2,3,4,5,6,7,8,10 may be correct. 

Select Clone 2,3,4,5 to mini-prep. 

Miniprep digestion 4/7/2012

[[Image:1030 EcoR1 Xho1 4 7 2012.jpg]]

Digest 1030 plasmid with Nco1 + EcoR1 + Xho1, why there is only 1 insert band?

[[Image:203 549 4 8 2012.jpg]]

[[Image:Phi29 gene synthesis 4 8 2012.jpg]]

 

4/9/2012 

digest 1030 miniprep , #2 and #3 (above) with Xho1, EcoR, Nco1 

[[Image:1030 4 9 2012 digestion 1.jpg]] 

[[Image:1030 4 9 2012 digestion 2.jpg]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 372px; height: 133px;"
|-
| Lane # 
| 1 
| 2 
| 3 
| 4 
| 5 
| 6 
| 7 
|-
| Sample # 
| 3 
| 3 
| 3 
| 4 
| 4 
| 4 
| pET28b vector 
|-
| Digestion
| Xho1-EcoR1 
| Nco1-Xho1 
| Nco1-EcoR1 
| Xho1-EcoR1 
| Nco1-Xho1 
| Nco1-EcoR1 
| Nco1-Xho1 
|-
| Insert 
| TEV 
| GST-TEV 
| GST 
| TEV 
| GST-TEV 
| GST 
| x 
|}

 

sequencing: #3 with T7 term: good 

4/17/2012 Expression in Nico21(DE3) cells:

[[Image:GST-TEV 4 17 2012.jpg]]

[[Image:GST-TEV_4_17_2012_2.jpg]]

1, 2, 5, 6, 7, 8, 9: after Ni and Glutathione beads

3, 4, 10,11, 12, 13,14, 15: After Ni beads

[[Category:Cloning]]

1030-pHis-GST-TEV - Revision history

Paul.xu at 19:44, 17 April 2012