https://eln.excellgen.com/index.php?action=history&feed=atom&title=1045_pT7A3-T4-DNA-Kinase
1045 pT7A3-T4-DNA-Kinase - Revision history
2026-10-18T02:16:37Z
Revision history for this page on the wiki
MediaWiki 1.44.0
https://eln.excellgen.com/index.php?title=1045_pT7A3-T4-DNA-Kinase&diff=7769&oldid=prev
Paul.xu at 14:31, 4 January 2013
2013-01-04T14:31:57Z
<p></p>
<p><b>New page</b></p><div>== '''Cloning of 1045 pT7A3-T4-DNA-Kinase''' ==<br />
<br />
'''Purpose:''' Cloning of 1045 pT7A3-T4-DNA-Kinase<br />
<br />
'''Date: '''December 26, 2012<br> <br />
<br />
'''Notebook:&nbsp;''' <br />
<br />
'''Page:''' <br />
<br />
'''Clone ID: 1045''' <br />
<br />
'''Experimenters: '''Jennifer Truong <br />
<br />
== '''Results''' ==<br />
<br />
=== Cloning ===<br />
<br />
----<br />
<br />
PCR using T4 phage genomic DNA <br />
<br />
T4DNAKinase-Nde1-F&nbsp; cgatca catatg aaaaagattattttgactattg<br>T4DNAKinase-Xho1-R&nbsp; tagctgctcgagaaaatctcccgaagcgacttgcc<br> <br />
<br />
See lane 1 (~907 bp), ladder ran off the gel<br> <br />
<br />
[[Image:1045 Template.JPG]] <br />
<br />
Cut out gel, purify, save for tomorrow to digest <br />
<br />
Date:&nbsp;Jan 4, 2013<br><br />
<br />
PCR using T4 phage genomic DNA (1 uL&nbsp;of 1:10 dilution - unpurified) and the following primers <br><br />
<br />
T4DNAKinase-Nde1-F cgatca catatg aaaaagattattttgactattg<br>T4DNAKinase-Xho1-R tagctgctcgagaaaatctcccgaagcgacttgcc<br />
<br />
See lane 2 (~907 bp)<br><br />
<br />
[[Image:1123_1045_Amp.JPG]]<br><br />
<br />
Cut out band, and purify<br />
<br />
Digest insert (lane ) and vector (1514 pT7A3-MBP-(3C) lane ) with RE Nde1 and Xho1<br />
<br />
Cut out bands, ligate together and transform <br><br />
<br />
=== Colony Screening ===<br />
<br />
<br />
<br />
== '''Result intepretation/Summary''' ==<br />
<br />
<br> <br />
<br />
== '''Conclusion''' ==<br />
<br />
<br> <br />
<br />
[[Category:Cloning]]</div>
Paul.xu