Paul.xu at 15:59, 19 October 2012

2012-10-19T15:59:15Z

New page

== '''Cloning of pET8XHis-DeepVent-Exo''' ==

'''Purpose:''' Cloning of pET8XHis-DeepVent-Exo

'''Date: '''June 22, 2012 

'''Notebook: '''

'''Page:'''

'''Clone ID: '''1248

'''Experimenters: '''Jennifer Truong

== '''Results''' ==

=== Cloning ===

Date: June 22, 2012 

Amplified sequence with KAPA (see lane 2), expected size 598 bp 

Cut out band for DNA purifaction and digested with Nde1 and Nco1with pET8XHis (286) 

[[Image:1248 Amp.JPG]] 

[[Image:0622 Digestion.JPG]] 

Digested with Nde1 and Nco1with pET8XHis (286), need to redigest vector 

May have accidentally switched samples, reamplified sequence

[[Image:0622 Amp.JPG]]

Cut out band in lane 2 (expected size = 600 bp), placed in tube in gel, will purify and digest on Monday

Date: June 25, 2012

Digested 1248 with Vector 286 (pET 8X-His) with Ndel and Ncol

[[Image:0625 Digestion.JPG]] 

See lanes 5 and 6, cut out the bands, purified and ligated 

Date: June 27, 2012 

Was not successfullly cloned, may be because of the very weak vector band, or did not ligate/digest long enough (see lane 6) 

Reamplified DNA, see lane 2 

[[Image:0627 amp.JPG]] 

Cut out band, purified DNA and digested with with Vector 286 (pET 8X-His) with Ndel and Ncol 

[[Image:0627 Digestion.JPG]] 

See lanes 4 and 5. Cut out insert from lane 4, and cut out vector band in lane 5. Purified and ligated together. Transformed with Top10 cells, plated on KAN resistant plates, grow overnight. 

Date: July 10, 2012 

[[Image:0710 amp.JPG]]

Amplified sequence see lane 2 expected size 598 bp

Cut out band for DNA purifaction and digested with Nde1 and Nco1with pET8XHis (286) 

[[Image:0710 digestion.JPG]] 

DNA digestion did not show up (see lane 3), maybe because DNA amplification band was very light 

Cut out digested vector (see lane 4) and saved in box for tomorrow, will reamplify DNA 

Date: July 11, 2012 

[[Image:1248 digestion.JPG]] 

Digested DNA with restriction enzymes Nde1 and Nco1, cut out band and purify 

Ligate together with digested vector from yesterday, transform with Top10 cells and grow overnight

Date: July 12, 2012 

Screening showed that the insert was 2x the expected size, start all over 

PCR DeepVent Exonuclease domain using 423 pET30b-DeepVent-sso7d as templateand these two primers

DeepVent-Exo-Nde1-F cgatcacatatggctgaagagctcaagttgctcgcatttg DeepVent-Exo-R (gtacgagctcggtagggagttctcc atg gct ggc ggt ggc ggt agccccaag) cttggggctaccgccaccgccagccatggagaactccctaccgagctcgtac 

 

[[Image:1248 0712 AMP.JPG]] 

See lanes 1 and 2, cut out bands, purify for digestion 

[[Image:1248 0712 digestion.JPG]] 

Digested DNA (lane 2) and pET8XHis 286 (lane 1) with restriction enzymes (Nde1 and Nco1) 

Cut out and purified bands, lligate together overnight

Transform with Top10 cells and plate on KAN plates tomorrow morning

=== Colony Screening ===

[[Image:1248 Screening.JPG]]

All negative, not succesfully transformed. May be because the vector is so light

Date: July 12, 2012

[[Image:1248 Screening PCR.JPG]]

There are positive inserts in lanes 3, 5, 6 and 8, but it is of the incorrect size. Expected is 600 bp but it looks like it is 2x the size

Date: July 16, 2012 

[[Image:1248 0716 Screening.JPG]] 

Sequencing came back bad, grow more bacteria from bacteria, redid MiniPrep, digested plasmids with RE Nde1 and Nco1. Expected size ~600 bp, redigest tomorrow

Date: July 17, 2012

[[Image:0717 Digestion.JPG]]

Digested sample 1 from MiniPrep yesterday (see lane 1), no band. Maybe digest sample 5

== '''Result intepretation/Summary''' ==

 

== '''Conclusion''' ==

 

== '''Cloning of 1248 pET8XHis-DeepVent-Exo''' ==

'''Purpose:''' Cloning of 1248 pET8XHis-DeepVent-Exo

'''Date: '''2012-9-25---2012-9-26

'''Notebook:0'''

'''Page:'''

'''Clone ID:1248'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:559+567+1248+1352 PCR 9-25-2012.JPG]] 

PCR DeepVent Exonuclease domain using 423 pET30b-DeepVent-sso7d as templateand these two primers

DeepVent-Exo-Nde1-F DeepVent-Exo-R 

 

[[Image:559+567+1352+1248+1106 clone 9-25-2012.JPG]] 

 

{| cellspacing="1" cellpadding="1" border="1" style="width: 281px; height: 66px;"
|-
| 
| band 5 
| band 6 
|-
| 
| pET8XHis 286 
| PCR product 
|-
| enzymes 
| colspan="2" |             Nde1+Nco1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-9-26

no clonies in plate 

 

 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

== '''Cloning of 1248 pET8XHis-DeepVent-Exo''' ==

'''Purpose:''' Cloning of 1248 pET8XHis-DeepVent-Exo

'''Date: '''2012-10-15---2012-10-18

'''Notebook:0'''

'''Page:'''

'''Clone ID:1248'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:240+559+567+1248_clone_10-16-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 281px; height: 66px;"
|-
| 
| band 8 
| band 7 
|-
| 
| pET8XHis 286 
| PCR product 
|-
| enzymes 
| colspan="2" |             Nde1+Nco1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-10-18

mini prep and digest with Nde1+Nco1

[[Image:559+567+1248_digest_detect_10-18-2012.JPG]] 

not the right size 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

[[Category:Cloning]]

1248 pET8XHis-DeepVent-Exo - Revision history

Paul.xu at 15:59, 19 October 2012