Paul.xu at 13:45, 4 September 2012

2012-09-04T13:45:04Z

New page

== '''Cloning of 1263-pCMV5-Fc(3c)-RIPK3''' ==

'''Purpose:''' Cloning of 1263-pCMV5-Fc(3c)-RIPK3

'''Date: '''2012--7-11----2012-7-11

'''Notebook:0'''

'''Page:'''

'''Clone ID:1263'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1263 PCR 7-12-2012.JPG]] 

PCR using 

template:kinase7899 A11 RIPK3-Nhe1-F atcgacc gct agc ATGTCGTGCGTCAAGTTATGGCCCAG RIPK3-<strike>Xho1</strike>-F '''wrong primer''' gtgctagctcgaGCTATTTCCCGCTATGATTATACCAAC 

 

[[Image:1263 clone 7-12-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 321px; height: 84px;"
|-
| 
|   lane 1 
|   lane 2 
|-
| 
| PCR product 
| pCMV5-Fc(3C) 1262 
|-
| enzymes 
| colspan="2" |            Xho1 + Nhe1 
|}

'''Looks like the vector is not right. It should not have a small band''' 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

 

 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

== '''Cloning of 1263-pCMV5-Fc(3c)-RIPK3''' ==

'''Purpose:''' Cloning of 1263-pCMV5-Fc(3c)-RIPK3

'''Date: '''2012-7-27---2012-7-30

'''Notebook:0'''

'''Page:'''

'''Clone ID:1263'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1263+1269 PCR 7-26-2012.JPG]] 

PCR using these primers RIPK3-Nhe1-F atcgacc gct agc ATGTCGTGCGTCAAGTTATGGCCCAG

RIPK3-Not1-R gatgcaagGCGGCCGCCTATTTCCCGCTATGATTATACCAAC 

[[Image:1263+1264+1269+1276+1284 clone 7-27-2012.JPG|369x271px|1263+1264+1269+1276+1284 clone 7-27-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 391px; height: 84px;"
|-
| 
| band 1 
| band 2 
|-
| 
| PCRproduct 
| 1262,pCMV5-Fc(3C) 
|-
| enzymes 
| colspan="2" |          Nhe1+  Not1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-7-30

Make miniprep and digest with Nhe1+ Not1 

[[Image:1263+1263+1269 digest detect 7-30-2012.JPG]] 

c 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

== '''Cloning of 1263-pCMV5-Fc(3c)-RIPK3''' ==

'''Purpose:''' Cloning of 1263-pCMV5-Fc(3c)-RIPK3

'''Date: '''2012-7-31---2012-8-2

'''Notebook:0'''

'''Page:'''

'''Clone ID:1263'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1263+1264+1269+1276 PCR 7-31-2012.JPG]] 

 

[[Image:1263+1269+1276+1282+1284 clone 7-31-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 281px; height: 66px;"
|-
| 
| band 1 
| band 2 
|-
| 
| PCRproduct 
| 1262,pCMV5-Fc(3C) 
|-
| enzymes 
| colspan="2" |           Nhe1+ Not1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-8-2

Make miniprep and digest with Nhe1+ Not1 

[[Image:1263 digest detect 8-2-2012.JPG]]

 

digest detect again: EcoR1+Not1

[[Image:1263 digest 2detect 8-2-2012.JPG]]

9/3/2012 

Digest Maxiprep DNA with

Nhe1+ Not1--> GOI

Not1 + Xba1--> to see if SVLT is in the vector

[[Image:9 3 2012.jpg]] 

{| width="200" cellspacing="1" cellpadding="1" border="1"
|-
| 1 
| 2 
| 3 
| 4 
| 5 
| 6 
| 7 
| 8 
| 9 
| 10 
| 11 
| 12 
|-
| 1224 
| 1263 
| 1264 
| 1269 
| 1276 
| 1284 
| 1224 
| 1263 
| 1264 
| 1269 
| 1276 
| 1284 
|-
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
|-
|
|
| lot of RNA
|
| lot of RNA
|
|
|
|
|
|
|
|}

1224: vector with SVLT, digest with Not1 + Nhe1: why so many bands?? 

1263: why multiple bands with Nhe1 + Not1 digestion? there is an internal Xba1 site, digest with

Not1 + Xba1 --> 500 bp

Transfection: cell aggreggation: 1284 and 1276

 

 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

[[Category:Cloning]]

1263-pCMV5-Fc(3c)-RIPK3 - Revision history

Paul.xu at 13:45, 4 September 2012