Paul.xu at 13:47, 4 September 2012

2012-09-04T13:47:03Z

New page

== '''Cloning of 1269-pCMV5-Fc(3c)-GNE''' ==

'''Purpose:''' Cloning of 1269-pCMV5-Fc(3c)-GNE

'''Date: '''2012-7-27---2012-7-30

'''Notebook:0'''

'''Page:'''

'''Clone ID:1269'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1263+1269 PCR 7-26-2012.JPG]] 

PCR using GNE-Nhe1-F atcgca gct agc ATGGAGAAGAATGGAAATAAC GNE-Xba1-R gatgctTCTAGACtAGTAGATCCTGCGTGTTGTGTAG 

 

[[Image:1263+1264+1269+1276+1284 clone 7-27-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 439px; height: 84px;"
|-
| 
| band 3 
| band 7 
|-
| 
| PCR product 
| 1262,pCMV5-Fc(3C) 
|-
| enzymes 
| colspan="2" |             Nhe1 + Xba1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-7-30

Make miniprep and digest with Nhe1 + Xba1 

[[Image:1263+1263+1269 digest detect 7-30-2012.JPG]] 

no insert

 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

== '''Cloning of 1269-pCMV5-Fc(3c)-GNE''' ==

'''Purpose:''' Cloning of 1269-pCMV5-Fc(3c)-GNE

'''Date: '''2012-7-31---2012-8-2

'''Notebook:0'''

'''Page:'''

'''Clone ID:1269'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1263+1264+1269+1276 PCR 7-31-2012.JPG]] 

GNE-Nhe1-F GNE-Xba1-R 

[[Image:1263+1269+1276+1282+1284 clone 7-31-2012.JPG]] 

{| width="348" cellspacing="1" cellpadding="1" border="1"
|-
| 
| band 5 
| band 6 
|-
| 
| PCR product 
| 1262,pCMV5-Fc(3C) 
|-
| enzymes 
| colspan="2" |             Nhe1 + Xba1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-8-2

Make miniprep and digest with Nhe1 + Xba1

no right clones 

 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

== '''Cloning of 1269-pCMV5-Fc(3c)-GNE''' ==

'''Purpose:''' Cloning of 1269-pCMV5-Fc(3c)-GNE

'''Date: '''2012-8-3---2012-8-6

'''Notebook:0'''

'''Page:'''

'''Clone ID:1269'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1264+1269+1276+1284 clone 8-3-2012.JPG]][[Image:1263-2 8-3-2012.JPG]] 

 

{| width="371" cellspacing="1" cellpadding="1" border="1"
|-
| 
| band 1 
| band 2 
|-
| 
| PCR product 
| 1263-2pCMV5-Fc(3c)-RIPK3 
|-
| enzymes 
| colspan="2" |             Nhe1+Xba1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-8-6

Make miniprep and digest with Nhe1+Xba1

No insert 

c 

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

== '''Cloning of 1269-pCMV5-Fc(3c)-GNE''' ==

'''Purpose:''' Cloning of 1269-pCMV5-Fc(3c)-GNE

'''Date: '''2012-8-7---2012-8-10

'''Notebook:0'''

'''Page:'''

'''Clone ID:1269'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

[[Image:1269+1284 PCR 8-7-2012.JPG]] 

GNE-Nhe1-F GNE-Not1-R 

[[Image:1269+1276+1284_clone_8-8-2012.JPG]][[Image:1263_digested_8-8-2012.JPG]] 

{| width="371" cellspacing="1" cellpadding="1" border="1"
|-
| 
| band 1 
| band 
|-
| 
| PCR product 
| 1263,pCMV5-Fc(3c)-RIPK3 
|-
| enzymes 
| colspan="2" |             Nhe1+Not1 
|}

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-8-10

Make miniprep and digest with Nhe1+Not1

[[Image:1264+1269 digest detect 8-10-2012.JPG]] 

9/3/2012 

Digest Maxiprep DNA with

Nhe1+ Not1--> GOI

Not1 + Xba1--> to see if SVLT is in the vector

[[Image:9 3 2012.jpg]] 

{| width="200" cellspacing="1" cellpadding="1" border="1"
|-
| 1 
| 2 
| 3 
| 4 
| 5 
| 6 
| 7 
| 8 
| 9 
| 10 
| 11 
| 12 
|-
| 1224 
| 1263 
| 1264 
| 1269 
| 1276 
| 1284 
| 1224 
| 1263 
| 1264 
| 1269 
| 1276 
| 1284 
|-
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Nhe1+ Not1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
| Not1+ Xba1 
|-
|
|
| lot of RNA
|
| lot of RNA
|
|
|
|
|
|
|
|}

1224: vector with SVLT, digest with Not1 + Nhe1: why so many bands?? 

1263: why multiple bands with Nhe1 + Not1 digestion? there is an internal Xba1 site, digest with

Not1 + Xba1 --> 500 bp

Transfection: cell aggreggation: 1284 and 1276

== '''Result intepretation/Summary''' ==

*&lt;br&gt;

== '''Conclusion''' ==

&lt;br&gt;

{| cellspacing="1" cellpadding="1"
|-
| 
|}

&lt;br&gt;

{| cellspacing="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

 

{|
|-
| 
|}

[[Category:Cloning]]

1269-pCMV5-Fc(3c)-GNE - Revision history

Paul.xu at 13:47, 4 September 2012