https://eln.excellgen.com/index.php?action=history&feed=atom&title=1740_pT7A3-8HZB2 1740 pT7A3-8HZB2 - Revision history 2026-10-18T06:31:38Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=1740_pT7A3-8HZB2&diff=9185&oldid=prev Paul.xu: Created page with "== '''Cloning of 1740 pT7A3-8HZB2''' == '''Purpose:''' Cloning of1740 pT7A3-8HZB2 '''Date: '''2013-5--- '''Notebook:0''' '''Page:''' '''Clone ID:1740''' '''Experiment..." 2013-05-20T19:45:09Z <p>Created page with &quot;== &#039;&#039;&#039;Cloning of 1740 pT7A3-8HZB2&#039;&#039;&#039; == &#039;&#039;&#039;Purpose:&#039;&#039;&#039; Cloning of1740 pT7A3-8HZB2 &#039;&#039;&#039;Date: &#039;&#039;&#039;2013-5--- &#039;&#039;&#039;Notebook:0&#039;&#039;&#039; &#039;&#039;&#039;Page:&#039;&#039;&#039; &#039;&#039;&#039;Clone ID:1740&#039;&#039;&#039; &#039;&#039;&#039;Experiment...&quot;</p> <p><b>New page</b></p><div>== &#039;&#039;&#039;Cloning of 1740 pT7A3-8HZB2&#039;&#039;&#039; ==<br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; Cloning of1740 pT7A3-8HZB2 <br /> <br /> &#039;&#039;&#039;Date: &#039;&#039;&#039;2013-5--- <br /> <br /> &#039;&#039;&#039;Notebook:0&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Page:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Clone ID:1740&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039; Shanyi <br /> <br /> == &#039;&#039;&#039;Results&#039;&#039;&#039; ==<br /> <br /> === cloning ===<br /> <br /> PCR Zbasic2 from 1705 pT7A3-ZB2-T4Lysozyme using &lt;br&gt;<br /> <br /> 6H-ZB2-Nco1-F atcgac CCATGGGCAGCAGCCATCATCATCATCATCAC cat cac gtcgacaacaagttcaacaag <br /> <br /> ZB2-E3C-Nde1-R (ctgaacgacgcgcagccgaag ctggaagttctgttccaggggccg catatg ctagca) tgctagcatatgcggcccctggaacagaacttccagcttcggctgcgcgtcgttcag <br /> <br /> [[Image:1740_1274pcr.JPG‎]]&lt;br&gt; <br /> <br /> digest with Nco1 + Nde1 <br /> <br /> [[Image:Digest_for_1740.JPG‎ ]]&lt;br&gt;<br /> <br /> &lt;br&gt; <br /> <br /> === Colony Screening ===<br /> <br /> Date: 2013-5-20 <br /> <br /> Make miniprep and digest with Nco1 + Nde1 <br /> <br /> [[Image:562fix_622_1144fix3_1740digest.JPG]]<br /> <br /> &lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> == &#039;&#039;&#039;Result intepretation/Summary&#039;&#039;&#039; ==<br /> <br /> == &#039;&#039;&#039;Conclusion&#039;&#039;&#039; ==<br /> <br /> [[Category:Cloning]]</div> Paul.xu