Crm at 15:34, 22 May 2018

2018-05-22T15:34:03Z

New page

== '''Cloning of 1995 pT3A3-Kfu-sso7d''' ==

'''Purpose:''' Cloning of1995 pT3A3-Kfu-sso7d

'''Date: '''2014-1----

'''Notebook:0'''

'''Page:'''

'''Clone ID:1995'''

'''Experimenters:'''  shanyi

== '''Results''' ==

=== cloning ===

PCR from 1949 pT3A3-Kfu-G590S-sso7d fragment 1: Kfu-S590G-F+Kfu-HindIII-R Fragment 2:Kfu-F1+Kfu-S590G-R [[File:1535 1588 1995-1PCR.JPG|RTENOTITLE]][[File:1693 1995-2PCR.JPG|RTENOTITLE]]

join two fragments using Kfu-F1 cgacCATATGGCTAGCGCCattctggatactgactacattaccgaagatggaaagccggtcataCGTattttcaag Kfu-HindIII-R (GAGGGTTCTTGAAGCTTTGCTAA) TTAGCAAAGCTTCAAGAACCCTC

[[File:1535 1588 1942 1995pcr.JPG|RTENOTITLE]]

clone fragment back into Nde1 + HindIII digested 1949 pT3A3-Kfu-G590S-sso7d using Nde1 + HindIII

[[File:Digest pcrfor 1561 1631 1693 1942 1995.JPG|RTENOTITLE]]

[[File:2digest vectors for 1561 1631 1693 1942 1995.JPG|RTENOTITLE]]

=== Colony Screening ===

Date: 2013-10-23

Make miniprep, digest with NdeI+XHOI

[[File:1561 1631 1693 1942 1995digest.JPG|RTENOTITLE]]

== '''Result intepretation/Summary''' ==

*

== '''Conclusion''' ==

== '''Protein Purification & QC''' ==

'''1/13/2018''' [[File:1995 PCR QC.JPG|RTENOTITLE]]

'''Storage buffer'''

20 mM Tris-HCl (pH 7.4 at 25 °C)

0.1 mM EDTA

1 mM DTT

100 mM KCl

stabilizers (maybe 100 mM sorbitol )

5 % trihalose

200 μg/mL BSA and 50% glycerol.

QC_5/18/2018

Phusion_homemade:original concentration:2.5mg/ml

Kfu:original concentration:1.25mg/ml

{| border="1" cellspacing="1" cellpadding="1" style="width:500px;"
|-
| Name
| Lane
| 
| concentration
| note
|-
| Phusion, 
| 1
| 
| 1250ng/ul
| 
|-
| 
| 2
| 
| 625ng/ul
| 
|-
| 
| 3
| 
| 500ng/ul
| 
|-
| 
| 4
| 
| 250ng/ul
| 
|-
| 
| 5
| 
| 100ng/ul
| 
|-
| 
| '''6'''
| 
| '''50ng/ul'''
| '''good'''
|-
| 
| '''7'''
| 
| '''30ng/ul'''
| '''good'''
|-
| 
| '''8'''
| 
| '''15ng/ul'''
| '''good'''
|-
| 
| 9
| 
| 6ng/ul
| 
|-
| Kfu, 
| 1
| 
| 625ng/ul
| 
|-
| 
| 2
| 
| 500ng/ul
| 
|-
| 
| 3
| 
| 250ng/ul
| 
|-
| 
| 4
| 
| 100ng/ul
| 
|-
| 
| 5
| 
| 50ng/ul
| 
|-
| 
| '''6'''
| 
| '''30ng/ul'''
| '''good'''
|-
| 
| '''7'''
| 
| '''15ng/ul'''
| '''good'''
|-
| 
| '''8'''
| 
| '''6ng/ul'''
| '''good'''
|-
| 
| 9
| 
| 3ng/ul
| 
|}

[[File:IMG 0793.JPG|RTENOTITLE]]
[[Category:Cloning]]

1995 pT7A3-Kfu-sso7d - Revision history

Crm at 15:34, 22 May 2018