https://eln.excellgen.com/index.php?action=history&feed=atom&title=2229_pT7A3E-phoA 2229 pT7A3E-phoA - Revision history 2026-10-18T19:24:25Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=2229_pT7A3E-phoA&diff=13915&oldid=prev Excellgen at 21:35, 30 January 2015 2015-01-30T21:35:38Z <p></p> <p><b>New page</b></p><div>== &#039;&#039;&#039;Cloning of 2229 pT7A3E-phoA&#039;&#039;&#039; ==<br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; Cloning of2229 pT7A3E-phoA&#039;&#039;&#039;==&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Date: &#039;&#039;&#039;2015-1---- <br /> <br /> &#039;&#039;&#039;Notebook:0&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Page:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Clone ID:2229&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039;&amp;nbsp; shanyi <br /> <br /> == &#039;&#039;&#039;Results&#039;&#039;&#039; ==<br /> <br /> === CLONING ===<br /> <br /> PCR from Thermus thermophilus HB27 genomic DNA <br /> <br /> 1. Tth-phoA-Nde1-F tcgaacatatgaagcgaagggacatcctg <br /> <br /> Tth-phoA-dXho1-R ctcggcgtcctcCaggtccacAcccttcatg <br /> <br /> 2. Tth-phoA-dXho1-F catgaagggTgtggacctGgaggacgccgag <br /> <br /> Tth-phoA-Xho1-R (caccccgaggacgtctgggccctcgagtatact) agtatactcgagggcccagacgtcctcggggtg <br /> <br /> [[Image:2401-1 2198 2229-1 736fix3-1pcr.JPG]][[Image:2229-2 736fix3-2pcr.JPG]] <br /> <br /> 3. Gel purify and then join two fragments Tth-phoA-Nde1-F tcgaacatatgaagcgaagggacatcctg Tth-phoA-Xho1-R (caccccgaggacgtctgggccctcgagtatact) agtatactcgagggcccagacgtcctcggggtg&lt;br&gt; [[Image:2198 2401 2229pcr.JPG]]&lt;br&gt; <br /> <br /> digest with Nde1 + EcoR1, clone to1982&lt;br&gt; <br /> <br /> [[Image:Digest for 736fix3 2198 2229 2416.JPG]]&lt;br&gt;&lt;br&gt; <br /> <br /> === Colony Screening ===<br /> <br /> Date: 2015_1_ <br /> <br /> Make miniprep, use&amp;nbsp;Nde1 + Nco1 to find positive clone&lt;br&gt; <br /> <br /> [[Image:736fix3 2198 2229digest.JPG]]&lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> &lt;br&gt; &lt;br&gt; <br /> <br /> == &#039;&#039;&#039;Result intepretation/Summary&#039;&#039;&#039; ==<br /> <br /> *&lt;br&gt;<br /> <br /> == &#039;&#039;&#039;Conclusion&#039;&#039;&#039; ==<br /> <br /> [[Category:Cloning]]</div> Excellgen