https://eln.excellgen.com/index.php?action=history&feed=atom&title=2268_pHCMC04-iFLP 2268 pHCMC04-iFLP - Revision history 2026-10-18T11:51:07Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=2268_pHCMC04-iFLP&diff=12587&oldid=prev Excellgen at 20:35, 28 July 2014 2014-07-28T20:35:17Z <p></p> <p><b>New page</b></p><div>== &#039;&#039;&#039;Cloning of 2268 pHCMC04-iFLP&#039;&#039;&#039; ==<br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; Cloning of2268 pHCMC04-iFLP&#039;&#039;&#039;==&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Date: &#039;&#039;&#039;2014-7---- <br /> <br /> &#039;&#039;&#039;Notebook:0&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Page:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Clone ID:2268&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039;&amp;nbsp; shanyi <br /> <br /> == &#039;&#039;&#039;Results&#039;&#039;&#039; ==<br /> <br /> === CLONING ===<br /> <br /> PCR from 2115&lt;br&gt; <br /> <br /> 6His-BamH1-F tactaggatccatgggccatcaccatcaccatcac <br /> <br /> iFLP-Xma1-R (catcaatcgtcgcatctaa ctcgag cccggg tactaa) ttagtacccgggctcgagttagatgcgacgattgatg <br /> <br /> [[Image:2268pcr.JPG]]&lt;br&gt; digest with BamH1+ Xma1, clone to 2271 pHCMC04&lt;br&gt; <br /> <br /> [[Image:Digest for 735 2268 2273.JPG]]&lt;br&gt;&lt;br&gt; <br /> <br /> === Colony Screening ===<br /> <br /> Date: 2014_7<br /> <br /> Make miniprep, use XhoI to find positive clone&lt;br&gt; <br /> <br /> [[Image:735 2279DIGEST.JPG]]&lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> use BamH1+ Xma1&amp;nbsp; to verify&lt;br&gt; <br /> <br /> [[Image:735 2268 2273DIGEST.JPG]] <br /> <br /> &lt;br&gt; <br /> <br /> == &#039;&#039;&#039;Result intepretation/Summary&#039;&#039;&#039; ==<br /> <br /> *&lt;br&gt;<br /> <br /> == &#039;&#039;&#039;Conclusion&#039;&#039;&#039; ==<br /> <br /> [[Category:Cloning]]</div> Excellgen