https://eln.excellgen.com/index.php?action=history&feed=atom&title=2474_pET30-HA-Tn5-6His 2474 pET30-HA-Tn5-6His - Revision history 2026-10-19T13:53:19Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=2474_pET30-HA-Tn5-6His&diff=15567&oldid=prev Paul.xu at 23:03, 17 February 2017 2017-02-17T23:03:23Z <p></p> <p><b>New page</b></p><div>== &#039;&#039;&#039;Cloning of 2474 pET30-HA-Tn5-6His&#039;&#039;&#039; ==<br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; Cloning of 2474 pET30-HA-Tn5-6Hisby PCR<br /> <br /> &#039;&#039;&#039;Date: &#039;&#039;&#039;2017-2-17<br /> <br /> &#039;&#039;&#039;Notebook:&amp;nbsp;&#039;&#039;&#039;<br /> <br /> &#039;&#039;&#039;Page:&#039;&#039;&#039;<br /> <br /> &#039;&#039;&#039;Clone ID: 2474&#039;&#039;&#039;<br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039;<br /> <br /> == &#039;&#039;&#039;Results&#039;&#039;&#039; ==<br /> <br /> cloning<br /> <br /> PCR from 2460 pTXB1-Tn5<br /> <br /> 2443-HA-Tn5-Nde1-F B3 gatatacatatgattaccagtg<br /> <br /> 2474-HA-Tn5-C-6His-Xho1-R1 B5 gatgcactcgaggattttaatgccctgcgccatc<br /> <br /> <br /> <br /> <br /> <br /> == &#039;&#039;&#039;Result intepretation/Summary&#039;&#039;&#039; ==<br /> <br /> == &#039;&#039;&#039;Conclusion&#039;&#039;&#039; ==<br /> <br /> {| cellpadding=&quot;1&quot; cellspacing=&quot;1&quot;<br /> |-<br /> | &lt;br/&gt;<br /> |}<br /> <br /> <br /> <br /> {| cellpadding=&quot;1&quot; cellspacing=&quot;1&quot;<br /> |-<br /> | &lt;br/&gt;<br /> |}<br /> <br /> <br /> <br /> {| cellspacing=&quot;1&quot;<br /> |-<br /> | &lt;br/&gt;<br /> |}<br /> [[Category:Cloning]]</div> Paul.xu