Ruili.su at 19:56, 10 February 2012

2012-02-10T19:56:17Z

New page

== '''Cloning of 323-pLenti-EF1-MCS''' ==

'''Purpose:''' Cloning of 323-pLenti-EF1-MCS

'''Date: '''2011-12-28

'''Notebook:'''

'''Page:'''

'''Clone ID:323'''

'''Experimenters:''' yingying

== '''Results''' ==

'''[[Image:323 PCR 12-29-2011.JPG]]''' 

'''template: pPuroGreen 178''' 

Primer-F EF1-<strike>NdeI</strike>-F agct GCTAGC c gtgaggctcc ggtgcccg Primer-R EF1-BamH1-R (cttccatttcaggtgtcgtga GGATCC atcg) cgatGGATCCtcacgacacctgaaatggaag 

[[Image:169+323+459 clone 12-29-2011.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 393px; height: 96px;"
|-
| 
| band 3 
| band 4 
|-
| 
| PCR product 
| pLenti-Plus (152) 
|-
| digest enzyme 
| colspan="2" |          <strike>Nde1</strike> + BamH1 
|}

 

=== Subcloning ===

Date: 

 

=== Colony Screening ===

Date: 2012-1-3 

Make miniprep and digest with <strike>Nde1</strike> + BamH1 

[[Image:169+323 digest detect 1-3-2012.JPG]]

  '''Result intepretation/Summary'''

== ==

== '''Conclusion''' ==

=== ===

 --[[User:Yingying.lu|Yingying.lu]] 15:05, 29 December 2011 (EST)

 

== '''Cloning of 323-pLenti-EF1-MCS''' ==

'''Purpose:''' Cloning of 323-pLenti-EF1-MCS

'''Date: '''2012-1-4

'''Notebook:'''

'''Page:'''

'''Clone ID:323'''

'''Experimenters:''' yingying

== '''Results''' ==

[[Image:323 PCR 1-4-2012.JPG]] 

'''template: pPuroGreen 178''' 

Primer-F EF1-<strike>NdeI</strike>-F agct GCTAGC c gtgaggctcc ggtgcccg Primer-R EF1-BamH1-R (cttccatttcaggtgtcgtga GGATCC atcg) cgatGGATCCtcacgacacctgaaatggaag 

[[Image:323 clone 1-4-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 393px; height: 96px;"
|-
| 
| band 1 
| band 2 
|-
| 
| PCR product 
| pLenti-Plus (152) 
|-
| digest enzyme 
| colspan="2" |          <strike>Nde1</strike> + BamH1 
|}

 

=== Subcloning ===

Date: 

 

=== Colony Screening ===

Date: 2012-1-6 

Make miniprep and digest with <strike>Nde1</strike> + BamH1 

[[Image:323 digest detct 1-6-2012.JPG]]

 

  '''Result intepretation/Summary'''

== ==

== '''Conclusion''' ==

=== ===

 --[[User:Yingying.lu|Yingying.lu]] 15:05, 29 December 2011 (EST)

== '''Cloning of 323-pLenti-EF1-MCS''' ==

'''Purpose:''' Cloning of 323-pLenti-EF1-MCS by PCR 

'''Date: '''2012-1-26--

'''Notebook:'''

'''Page:'''

'''Clone ID:323'''

'''Experimenters:''' yingying

== '''Results''' ==

 

=== cloning ===

Date: 2012-1-26

[[Image:544+323 PCR 1-26-2012.JPG]] 

Primer-F EF1-NdeI-F agct CATATG c gtgaggctcc ggtgcccg Primer-R EF1-BamH1-R (cttccatttcaggtgtcgtga GGATCC atcg) cgatGGATCCtcacgacacctgaaatggaag 

[[Image:323+534 clone 1-27-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 426px; height: 80px;"
|-
| 
| band 3 
| band 4 
|-
| 
| PCR product 
| 152 pLenti-plus 
|-
| digestion enzymes 
| colspan="2" |             Nde1 + BamH1 
|}

 

=== Colony Screening ===

Date: 2012-1-30 

Make miniprep and digest with  Nde1 + BamH1 

[[Image:323+534+535 digest detect 1-30-2012.JPG]] 

clone 1,2,5 may be right, need to sequence

 

 

 

== '''Result intepretation/Summary''' ==

*sequencing :no priming ,need to clone again 

== '''Conclusion''' ==

 

=== ===

 

== '''Cloning of 323-pLenti-EF1-MCS''' ==

'''Purpose:''' Cloning of 323-pLenti-EF1-MCS by PCR 

'''Date: '''2012-2-7--2012-2-10

'''Notebook:003732'''

'''Page:'''

'''Clone ID:323'''

'''Experimenters:''' yingying

== '''Results''' ==

=== cloning ===

Date:2012-2-7

[[Image:323 PCR 2-7-2012.JPG]] 

template:178- pGreenPuro(EF1) 

 

Primer-F EF1-NdeI-F agct CATATG c gtgaggctcc ggtgcccg Primer-R EF1-BamH1-R (cttccatttcaggtgtcgtga GGATCC atcg) cgatGGATCCtcacgacacctgaaatggaag

[[Image:323+1004 clone 2-8-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 384px; height: 96px;"
|-
| 
| band 1 
| band 2 
|-
| 
| PCR product 
| 152 pLenti-plus 
|-
| digest enzymes 
| colspan="2" | Nde1 + BamH1 
|}

 

 

{| cellspacing="1" cellpadding="1" border="1"
|-
| 
|}

=== Colony Screening ===

Date: 2012-2-10

Make miniprep and digest with Nde1 + BamH1 

[[Image:323+1004_digest_detect_2-10-2012.JPG]]

 no insert 

== '''Result intepretation/Summary''' ==

* 

== '''Conclusion''' ==

 

{| cellspacing="1" cellpadding="1"
|-
| 
|}

 

{| cellspacing="1" cellpadding="1"
|-
| 
|}

 

{| cellspacing="1"
|-
| 
|}

[[Category:Cloning]]

323-pLenti-EF1-MCS - Revision history

Ruili.su at 19:56, 10 February 2012