https://eln.excellgen.com/index.php?action=history&feed=atom&title=327_pLenti-Dest 327 pLenti-Dest - Revision history 2026-10-18T08:48:23Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=327_pLenti-Dest&diff=2664&oldid=prev Yingying.lu at 14:43, 6 December 2011 2011-12-06T14:43:10Z <p></p> <p><b>New page</b></p><div>&#039;&#039;&#039;Cloning of pLenti-Dest (327)&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; to clone pLenti-Dest by PCR <br /> <br /> &#039;&#039;&#039;Date:&#039;&#039;&#039; 2011-11-28 to 2011-12- <br /> <br /> &#039;&#039;&#039;Notebook:&#039;&#039;&#039; Xiaojing Wang <br /> <br /> &#039;&#039;&#039;Page: &#039;&#039;&#039;004127---004131 <br /> <br /> &#039;&#039;&#039;Clone ID:&#039;&#039;&#039; 327 <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039; Xiaojing Wang <br /> <br /> &#039;&#039;&#039;Results&#039;&#039;&#039; <br /> <br /> [[Image:327 326 373 PCR 11.29.2011.JPG]]&lt;br&gt; The left bands show PCR product of 327, <br /> <br /> Primer-F LV-GW-SpeI-F aactc ACTAGT ATCAACAAGTTTGTACAAAAAAG <br /> <br /> Primer-R ad-GW-R Xho1 (TCTTGTACAAAGTGGTTGATtacccatacgatgttccagattacgcttgaCTCGAGatcga) tcgatCTCGAGtcaagcgtaatctggaacatcgtatgggtaATCAACCACTTTGTACAAGA <br /> <br /> &lt;br&gt; <br /> <br /> Digest result: <br /> <br /> [[Image:327 326 373 PCR digest 11.29.2011 S.JPG|153x269px|327 326 373 PCR digest 11.29.2011 S.JPG]][[Image:327 326 373 vector digest 11.29.2011.JPG|356x270px|327 326 373 vector digest 11.29.2011.JPG]] <br /> <br /> &lt;br&gt; <br /> <br /> digest PCR product and vector with Spe I+Xho I,run gel <br /> <br /> the left picture shows 327 insert, the middle picture shows 327 vector (pLentiPlus, 152)&amp;nbsp; <br /> <br /> gel purify, ligate, transform ccdb survival,AMP <br /> <br /> &lt;br&gt; <br /> <br /> Colony Screening <br /> <br /> [[Image:327 plasmid digest 12.1.2011 s.JPG]]&lt;br&gt; <br /> <br /> Select 6 clones to mini-prep, digestd by Spe I and Xho I. 327-1,-2,-3,-6 may be correct. Control is 327-1.&lt;br&gt; <br /> <br /> pDonr221_EGFP(393) + pLenti-Dest(327-6) make gateway by LR Clonase II. <br /> <br /> Transform 393+327-6 by STBL3, Amp. <br /> <br /> Select 4 clones to mini-prep. &lt;br&gt; <br /> <br /> 327+393-1,-2,-3,-4 plasmids transfect 293T cell line.<br /> <br /> 48 hours after transfection, take pictures. &lt;br&gt; <br /> <br /> &lt;br&gt;<br /> <br /> &lt;br&gt;<br /> <br /> 327+393-1,-2,-3,-4 plasmids are digested by BamHI. 327+393-4 is control.<br /> <br /> Band 1-4 is 327+393-1,-2,-3,-4 digested by BamHI.<br /> <br /> 327+393-1,-2,-3,-4 plasmids may be correct. &lt;br&gt; <br /> <br /> [[Image:327+393 digest 12.5.2011.JPG|372x468px]]&lt;br&gt; &lt;br&gt; <br /> <br /> [[Category:Cloning]]</div> Yingying.lu