https://eln.excellgen.com/index.php?action=history&feed=atom&title=332-pLenti-RFP-LoxP-GFP 2026-10-18T10:19:46Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=332-pLenti-RFP-LoxP-GFP&diff=1780&oldid=prev 2011-09-23T13:28:16Z

<p></p> <p><b>New page</b></p><div>&#039;&#039;&#039;Cloning of pLenti-RFP-LoxP-GFP (332)&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; to clone pLenti-RFP-LoxP-GFP by PCR <br /> <br /> &#039;&#039;&#039;Date:&#039;&#039;&#039; 2011-9-20 to 2011-9- <br /> <br /> &#039;&#039;&#039;Notebook:&#039;&#039;&#039; Xiaojing Wang <br /> <br /> &#039;&#039;&#039;Page: &#039;&#039;&#039;004095---004096 <br /> <br /> &#039;&#039;&#039;Clone ID:&#039;&#039;&#039; 332 <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039; Xiaojing Wang <br /> <br /> &#039;&#039;&#039;Results&#039;&#039;&#039; <br /> <br /> [[Image:332 PCR 9.20.2011.JPG|146x357px|332 PCR 9.20.2011.JPG]][[Image:332 PCR vector 9.21.2011.JPG|169x331px|332 PCR vector 9.21.2011.JPG]]&lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> TagGFP was amplified by gene synthesis.&lt;br&gt; <br /> <br /> The right band shows PCR product of LoxP-TagGFP, TagGFP as template&lt;br&gt; <br /> <br /> LoxP-TagGFP-EcoR1-F C4 atcga gaattc ATAACTTCGTATA ATG TAT GC T ATA CGA AGT TAT AGC GGG GGC GAG GAG CTG <br /> <br /> TagGFP-R1 XhoI (CACGGCATGGACGAGCTGTACAGGTAA ctcgag atcga) tcgatctcgagTTACCTGTACAGCTCGTCCATGCCGTG&lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> Digest result: <br /> <br /> [[Image:332 PCR digestion 9.22.2011.JPG|123x291px|332 PCR digestion 9.22.2011.JPG]][[Image:Vector digestion 9.21.2011.JPG]] <br /> <br /> digest PCR product and pLenti-mKate2 vector with 0.5ul EcoR1+ 0.8ul Xho1 at 37 for 1 hour , run gel <br /> <br /> gel purify, ligate, transform STBL3&amp;nbsp; (Amp)&lt;br&gt;<br /> <br /> &lt;br&gt; <br /> <br /> Colony Screening <br /> <br /> &lt;br&gt; &lt;br&gt; <br /> <br /> [[Category:Cloning]]</div>

Ruili.su