https://eln.excellgen.com/index.php?action=history&feed=atom&title=353-pET28TaqMuts 2026-10-18T08:06:19Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=353-pET28TaqMuts&diff=1619&oldid=prev 2011-09-05T00:06:25Z

<p>Created page with &quot;== &#039;&#039;&#039;Cloning of TaqMuts to pET28b&#039;&#039;&#039; == &#039;&#039;&#039;Purpose:&#039;&#039;&#039; cloning of TaqMuts to pET28b (353). &#039;&#039;&#039;Date: &#039;&#039;&#039;2011-9-4 to 2011-9-  &#039;&#039;&#039;Notebook:&#039;&#039;&#039; &#039;&#039;&#039;Page:&#039;&#039;&#039; &#039;&#039;&#039;Clone I...&quot;</p> <p><b>New page</b></p><div>== &#039;&#039;&#039;Cloning of TaqMuts to pET28b&#039;&#039;&#039; ==<br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; cloning of TaqMuts to pET28b (353). <br /> <br /> &#039;&#039;&#039;Date: &#039;&#039;&#039;2011-9-4 to 2011-9-&amp;nbsp; <br /> <br /> &#039;&#039;&#039;Notebook:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Page:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Clone ID:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039; Paul&lt;br&gt; <br /> <br /> == &#039;&#039;&#039;Results&#039;&#039;&#039; ==<br /> <br /> === PCR ===<br /> <br /> Use <br /> <br /> Primer-F Taq-Muts-F cata cat atggaaggcat gctgaagggc&lt;br&gt;Primer-R Taq-Muts-R cgatgaattctcaccccttcatggtatccaag<br /> <br /> 2.5 ul DMSO in 50 ul reaction.<br /> <br /> Phusion HiFi Polymerase<br /> <br /> 2.5 min extension, 25 cycles<br /> <br /> [[Image:193_Kpn1_Sal1_TaqMuts.jpg]]<br /> <br /> --[[User:Paul.xu|Paul.xu]] 19:06, 4 September 2011 (EST)<br /> <br /> === Colony Screening ===<br /> <br /> <br /> <br /> == &#039;&#039;&#039;Result intepretation/Summary&#039;&#039;&#039; ==<br /> <br /> *&lt;br&gt;<br /> <br /> == &#039;&#039;&#039;Conclusion&#039;&#039;&#039; ==<br /> <br /> Restriction digestion &lt;br&gt; <br /> <br /> Shows&amp;nbsp; &lt;br&gt; <br /> <br /> [[Category:Cloning]]</div>

Paul.xu