Paul.xu at 19:46, 30 September 2013

2013-09-30T19:46:47Z

New page

== '''Cloning of 367pEC-pfu''' ==

'''Purpose:''' Cloning of367pEC-pfu

'''Date: '''2013-5-

'''Notebook:'''

'''Page:'''

'''Clone ID:367'''

'''Experimenters:''' Shanyi

== '''Results''' ==

=== cloning ===

 PCR, use the following two pairs of primers and use 381 as template 

  PCR1 

  Pfu-Nde1-F1   tatgattttagatgtggattac

  Pfu-Kpn1-R1  (ctggcttaacattaaaaaatcc ggtac)  gtaccggattttttaatgttaagccag 

 PCR2 

  Pfu-Nde1-F2   tgattttagatgtggattac

  Pfu-Kpn1-R2   ctggcttaacattaaaaaatcc g   cggattttttaatgttaagccag

PCR:

PCR 1 Pfu-Nde1-F1 + Pfu-Kpn1-R1

TATG---pfu--- GGTAC

PCR 2 Pfu-Nde1-F2 + Pfu-Kpn1-R2 AC----pfu---- C

Mix two PCR reactions, denature and reannealat least 25%

Nde1 TATG----pfu--- GGTAC    AC----pfu---- C

[[Image:367PCRUSE381AS TEMPLATE.JPG]] 

Run gel, cut out bands, put into the same tube (i.e., one tube), add DG buffer, heat at 65 oC until dissolve, purify with spin column, elute with 20 ul water. Heat 95 oC for 10min, turn off PCR machine, cool slowly to room temp.

[[Image:DIGEST FOR 367.JPG]]

Add to purified NdeI+KpnI digested vector (at least 1:4 ratio, 1 vector + 4 Insert),ligate and transform 

 

=== Colony Screening ===

Date: 2013

DIGEST WITH NdeI+KpnI+XbaI 

[[Image:367digest.JPG]] send 367-1 to sequence, there are several mutations needed to fix

 

=== Fix mutations ===

 PCR 

  use 367-1 as template and use the following four pairs of primers to fix the mutations 

Pfu-Nde1-F1 + Pfu-fix-R3===>660bp 

Pfu-fix-F3 + Pfu-fix-R1===>1000bp 

Pfu-fix-F1 + Pfu-fix-R2===>360bp 

Pfu-fix-R2 + Pfu-Kpn1-R1===>300bp 

use phusion HS polymerase, 24cycles

[[Image:367fix mutations1.JPG]] 

then join four fragments by PCR :(use 0.15ul Phusion HS polymerase and 0.1ul Q5 hot start polymerase for each PCR reaction, extention time:2min30s, 25cycles) 

PCR 1 Pfu-Nde1-F1 + Pfu-Kpn1-R1

TATG---pfu--- GGTAC

PCR 2 Pfu-Nde1-F2 + Pfu-Kpn1-R2 AC----pfu---- C

[[Image:367fix mutations.JPG]] 

Mix two PCR reactions, denature and reannealat least 25%

Nde1           Kpn1 TATG----pfu--- GGTAC AC----pfu---- C 

Run gel, cut out bands, put into the same tube (i.e., one tube), add DG buffer, heat at 65 oC until dissolve, purify with spin column, elute with 30 ul water. Heat 95 oC for 10min, turn off PCR machine, cool slowly to room temp.

Digest 1454pEC vector with Nde1+ Kpn1 

[[Image:DIGEST FOR 367.JPG]]

Add PCR products to purified NdeI+KpnI digested vector (at least 1:4 ratio, 1 vector + 4 Insert),

ligate(5ul 10*T4 ligase buffer and 2ul T4ligase )and transform NEB TURBO 

 

=== Colony Screening ===

Date: 2013

DIGEST WITH NdeI+KpnI+XbaI 

[[Image:367fix mutationsdigest.JPG]] 

 

== '''Cloning of 367pEC-pfu''' ==

'''Purpose:''' Cloning of367pEC-pfu

'''Date: '''2013-9-

'''Notebook:'''

'''Page:'''

'''Clone ID:367'''

'''Experimenters:''' Shanyi

== '''Results''' ==

=== FIX MUTATIONS ===

 PCR 

  use 367FIX-1 as template and use the following THREE pairs of primers to fix the mutations 

Pfu-Nde1-F1 + Pfu-fix4-R 

Pfu-fix4-F + Pfu-fix5-R 

Pfu-fix5-F + Pfu-Kpn1-R1 

use phusion HS polymerase, 24cycles

[[Image:367fix2-1-2.JPG]][[Image:367fix2-3.JPG]]

 

then join four fragments by PCR :(use 0.15ul Phusion HS polymerase and 0.1ul Q5 hot start polymerase for each PCR reaction, extention time:2min30s, 25cycles) 

PCR 1 Pfu-Nde1-F1 + Pfu-Kpn1-R1

TATG---pfu--- GGTAC

PCR 2 Pfu-Nde1-F2 + Pfu-Kpn1-R2 AC----pfu---- C

[[Image:367fix2pcr.JPG]] 

Mix two PCR reactions, denature and reannealat least 25%

Nde1           Kpn1 TATG----pfu--- GGTAC AC----pfu---- C 

Run gel, cut out bands, put into the same tube (i.e., one tube), add DG buffer, heat at 65 oC until dissolve, purify with spin column, elute with 30 ul water. Heat 95 oC for 10min, turn off PCR machine, cool slowly to room temp.

Digest V15PET30B +1454pEC vector with Nde1+ Kpn1 

[[Image:Digest_for_560_367fix2.JPG‎ ]] 

Add PCR products to purified NdeI+KpnI digested vector (at least 1:4 ratio, 1 vector + 4 Insert),

ligate(5ul 10*T4 ligase buffer and 2ul T4ligase )and transform NEB TURBO 

 

=== Colony Screening ===

Date: 2013

DIGEST WITH NdeI+KpnI+XbaI 

[[Image:367fix2digest2.JPG‎ ]] 

== '''Result intepretation/Summary''' ==

* 

== '''Conclusion''' ==

 

 

[[Category:Cloning]]

367pEC-pfu - Revision history

Paul.xu at 19:46, 30 September 2013