https://eln.excellgen.com/index.php?action=history&feed=atom&title=367pfu-pET30b
367pfu-pET30b - Revision history
2026-10-18T08:09:14Z
Revision history for this page on the wiki
MediaWiki 1.44.0
https://eln.excellgen.com/index.php?title=367pfu-pET30b&diff=3115&oldid=prev
Ruili.su at 13:55, 19 January 2012
2012-01-19T13:55:58Z
<p></p>
<p><b>New page</b></p><div>gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp <br />
<br />
Purpose: gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp. <br />
<br />
Date: 2011-8-15 <br />
<br />
Notebook: Haiyan <br />
<br />
Page:003023 <br />
<br />
Clone ID: 253 <br />
<br />
Experimenters: Haiyan<br>Results <br> <br />
<br />
[[Image:367pfu +pET30b-9-15-2011.JPG|203x191px|367pfu +pET30b-9-15-2011.JPG]] <br />
<br />
<br> <br />
<br />
Purpose: . <br />
<br />
Date: 2011-10-18-- <br />
<br />
Notebook: Yingying Lu<br> <br />
<br />
Page: <br />
<br />
Clone ID:367<br> <br />
<br />
Experimenters: Yingying Lu<br>Results <br> <br />
<br />
[[Image:367PCR product10-18-2011.JPG]]<br> <br />
<br />
band 1,2,3 show PCR 1<br> <br />
<br />
381 plasmid as template<br> <br />
<br />
Pfu-Nde1-F1 + Pfu-Kpn1-R1 <br />
<br />
TATG---pfu--- GGTAC <br />
<br />
band 4,5,6 PCR 2<br> <br />
<br />
381 plasmid as template<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C <br />
<br />
Run gel, cut out bands, put into the same tube (i.e., one tube), add QG buffer, heat at 65 oC until dissolve<br>purify with spin column, elute with 20 ul water.<br>Heat 95 oC for 5min, turn off PCR machine, cool slowly to room temp.<br> <br />
<br />
[[Image:367-PET30b-digest with Kpn10-17-2011.JPG]] <br />
<br />
first digest with Kpn1 ,fast digest enzyme for 45 min <br />
<br />
[[Image:367-PET30b-digest with Nde1 10-18-2011.JPG]] <br />
<br />
second digest with Nde1, NEB enzyme for 2 hours <br />
<br />
[[Image:367-digest detect10-21-2011.JPG]]<br> <br />
<br />
10 different clonies digest detect: Kpn1+Nde1<br> <br />
<br />
<br> <br />
<br />
Date: 2011-11-18-- <br />
<br />
Notebook: Yingying Lu <br />
<br />
Page: <br />
<br />
Clone ID:367 <br />
<br />
Experimenters: Yingying Lu<br>Results <br> <br />
<br />
[[Image:367PCR 11-18-2011.JPG]]<br> <br />
<br />
band&nbsp; show PCR 1 <br />
<br />
381 plasmid as template <br />
<br />
Pfu-Nde1-F1 + Pfu-Kpn1-R1 <br />
<br />
TATG---pfu--- GGTAC <br />
<br />
band&nbsp; PCR 2 <br />
<br />
381 plasmid as template<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C <br />
<br />
Run gel, cut out bands, put into the same tube (i.e., one tube), add QG buffer, heat at 65 oC until dissolve<br>purify with spin column, elute with 20 ul water.<br> <br />
<br />
Heat 95 oC for 5min, turn off PCR machine, cool slowly to room temp.<br> <br />
<br />
[[Image:367 digest-vector11-18-2011.JPG]]<br> <br />
<br />
band show digest vector<br> <br />
<br />
Nde1+Kpn1 <br />
<br />
[[Image:367+474 digest detect11-23-2011.JPG]] <br />
<br />
<br><br> <br />
<br />
<br> <br />
<br />
== '''Cloning of 367pfu-pET30b''' ==<br />
<br />
'''Purpose:''' Cloning of367pfu-pET30b by PCR<br> <br />
<br />
'''Date: '''2012-1-17-- <br />
<br />
'''Notebook:''' <br />
<br />
'''Page:''' <br />
<br />
'''Clone ID:367''' <br />
<br />
'''Experimenters:''' yingying <br />
<br />
== '''Results'''<br> ==<br />
<br />
[[Image:367+529_PCR_1-18-2012.JPG]]<br><br />
<br />
&nbsp;cold fusion cloning method<br><br />
<br />
template: 381-pSpeedET-Pfu <br>pfu-Nde1-F3 5 CTTTAAGAAGGAGATATA CATATG atgattttagatgtggattac 3<br>pfu-Kpn1-R3 GGCCTTGTCGTCGTCGTCGGTACC ggattttttaatgttaagccag <br><br />
<br />
<br />
<br />
Subcloning <br />
<br />
Date:&nbsp;2012- <br />
<br />
<br> <br />
<br />
<br> <br />
<br />
<br> <br />
<br />
<br> <br />
<br />
=== Colony Screening ===<br />
<br />
Date: 2012-<br> <br />
<br />
Make miniprep and digest with <br> <br />
<br />
<br> <br />
<br />
<br><br />
<br />
== '''Result intepretation/Summary''' ==<br />
<br />
*<br><br />
<br />
== '''Conclusion''' ==<br />
<br />
<br> <br />
<br />
=== ===<br />
<br />
<br> <br />
<br />
[[Category:Cloning]]</div>
Ruili.su