https://eln.excellgen.com/index.php?action=history&feed=atom&title=455_pGST 2026-10-18T08:42:48Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=455_pGST&diff=4118&oldid=prev 2012-05-06T15:25:31Z

<p>moved <a href="/index.php?title=455pGST" class="mw-redirect" title="455pGST">455pGST</a> to <a href="/index.php?title=455_pGST" title="455 pGST">455 pGST</a></p> <p><b>New page</b></p><div>Cloning of pGST (455)<br /> <br /> Purpose: to clone pGST by PCR<br /> <br /> Date: 2011-10-25 to 2011-10-28<br /> <br /> Notebook: Xiaojing Wang<br /> <br /> Page: 004108---004109<br /> <br /> Clone ID: 455<br /> <br /> Experimenters: Xiaojing Wang<br /> <br /> Results&lt;br/&gt;[[File:455 PCR 10.25.2011.JPG|166x305px|455 PCR 10.25.2011.JPG]]<br /> <br /> The bands show PCR product of 455,<br /> <br /> GST-Nde1-F agtca CATATGtcccctatactaggttattgg<br /> <br /> GST-EcoR1-R EcoR1 ggtggtggcgaccatcctcca gaa ttc atcga oligo tcgatgaattctggaggatggtcgccaccacc<br /> <br /> <br /> <br /> Digest result:<br /> <br /> [[File:455 PCR digest 10.25.2011.JPG|108x436px|455 PCR digest 10.25.2011.JPG]][[File:455 vecter digest 10.26.2011.JPG|115x437px|455 vecter digest 10.26.2011.JPG]]<br /> <br /> digest PCR product and vector with Nde1+EcoR1, run gel<br /> <br /> the left bands show 455 insert, the right bands show pET30b vector<br /> <br /> gel purify, ligate 2 hours, transform Top10,K+<br /> <br /> &lt;br/&gt;Colony Screening<br /> <br /> [[File:455 plasmid digest 10.28.2011.JPG|RTENOTITLE]]<br /> <br /> <br /> <br /> [[Category:Cloning]] &lt;br/&gt;</div>

Paul.xu