Yingying.lu at 19:28, 6 January 2012

2012-01-06T19:28:52Z

New page

Cloning of 493-pLVXPlus2-App-IRES-mCherry

Purpose: to subclone from 303 pLentiGP-App to pLVXPlus2-IRES-mCherry, 174 

Date: 2011-11-10----

Notebook:Lu yingying

Page:

Clone ID:493

Experimenters: lu yingying Results 

[[Image:456+493 clone11-8-2011.JPG]] 

method1:

digest 303 with BamH1 + Nhe1--> insert(band3), ligate to BamH1 + PmeI digested pLVXPlus2-IRES-mCherry, 174(band4).

purify with OMEGA column then add pfu polymerase + dNTP to fill in (37C,1hour), ligate again.

transform STBL3. 

[[Image:237+469+493 digest detect 11-14-2011.JPG]]

digest detect: BamH1+Xho1

 

Date: 2011-11-15----

Notebook:Lu yingying

Page:

Clone ID:493

Experimenters: lu yingying Results 

[[Image:493 subclone 11-15-2011.JPG]] 

[[Image:493 subclone11-15-2011.JPG]] 

method1:

digest 303 with BamH1 + Nhe1--> insert(band3), ligate to BamH1 + PmeI digested pLVXPlus2-IRES-mCherry, 174(band4).

purify with OMEGA column then add pfu polymerase + dNTP to fill in (37C,1hour), ligate again.

transform STBL3.

 

Date: 2011-11-23----

Notebook:Lu yingying

Page:

Clone ID:493

Experimenters: lu yingying Results 

[[Image:493 PCR 11-23-2011.JPG]] 

method2:

PCR template is pCMV-SPORT6-App 305

using these primers App-BamH1-F atcga ggatcc gcc acc atgctgcccagcctggcactg

App-HindIII-Sfi1-R (gttctt tgagcagatg cagaactaa AAGCTT GGCCAAACAGGC atcgact) agtcgatGCCTGTTTGGCCAAGCTTttagttctgcatctgctcaaagaac

band 1,2,3 use high GC buffer  because of the GC content, band 4,5,6 use HIFi buffer 

[[Image:493 clone insert+vector11-23-2011.JPG]] 

Digest PCR product with BamH1 + Sfi1, digest pLVXPlus2-IRES-mCherry(174) vector with BamH1 + Sfi1 

 

Date: 2011-11-28----

Notebook:Lu yingying

Page:

Clone ID:493

Experimenters: lu yingying Results 

[[Image:493 insert+vector11-28-2011.JPG]] 

Digest PCR product (band 2) with BamH1 + Sfi1, digest pLVXPlus2-IRES-mCherry(174) vector with BamH1 + Sfi1(band 3) 

[[Image:461+493 digest detect 12-1-2011.JPG]] 

digest detect:BamH1 + Sfi1 

 

Date: 2011-12-2----

Notebook:Lu yingying

Page:

Clone ID:493

Experimenters: lu yingying Results 

[[Image:493 clone 1st digest12-2-2011.JPG]] 

1st Digest PCR product (band 1) with BamH1 , digest pLVXPlus2-IRES-mCherry(174) vector with BamH1 (band2) 

[[Image:493 sfi1 12-2-2011.JPG]] 

2nd Digest PCR product (band 1) with Sfi1 , digest pLVXPlus2-IRES-mCherry(174) vector with Sfi1 (band2) 

[[Image:493 digest detect 12-5-2011.JPG]] 

1st digest (band 1) with BamH1 ,then digest with Sfi1 

 

Date: 2011-12-12----

Notebook:Lu yingying

Page:

Clone ID:493

Experimenters: lu yingying Results 

[[Image:493 clone 12-13-2011.JPG]]

BamH1 NEB ,  for 2 hours ,then Sfil1 ,NEB,  for 5 hours in waterbath

[[Image:493 digest detect 12-16-2011.JPG]] 

BamH1 NEB ,for 2 hours ,then Sfil1 ,NEB,  for 2 hours in waterbath --[[User:Yingying.lu|Yingying.lu]] 10:06, 16 December 2011 (EST)

 

== '''Cloning of 493-pLVXPlus2-App-IRES-mCherry''' ==

'''Purpose:''' Cloning of 493-pLVXPlus2-App-IRES-mCherry by PCR 

'''Date: '''2011-12-21---

'''Notebook:'''

'''Page:'''

'''Clone ID:493'''

'''Experimenters:''' yingying

== '''Results''' ==

'''[[Image:459+493 PCR 12-19-2011.JPG]]''' method2:

PCR template is pCMV-SPORT6-App 305

using these primers App-BamH1-F atcga ggatcc gcc acc atgctgcccagcctggcactg

App-HindIII-Sfi1-R (gttctt tgagcagatg cagaactaa AAGCTT GGCCAAACAGGC atcgact) agtcgatGCCTGTTTGGCCAAGCTTttagttctgcatctgctcaaagaac

use HIFi buffer 

'''[[Image:475+477+493 clone 12-21-2011.JPG]]''' 

BamH1 NEB ,for 2 hours ,then Sfil1 ,NEB, for 4 hours in waterbath 

{| cellspacing="1" cellpadding="1" border="1" style="width: 359px; height: 96px;"
|-
| 
| band 5 
| band 6 
|-
| 
| PCR product '''(smear)''' 
| pLVXPlus2-IRES-mCherry(174) 
|-
| digest 
| BamH1 + Sfi1 
| BamH1 + Sfi1 
|}

BamH1 NEB ,for 2 hours ,then Sfil1 ,NEB, for 2 hours in waterbath 

=== Subcloning ===

Date:

 

=== Colony Screening ===

Date: 2011-12-29 

[[Image:478+493 digest detect 12-29-2011.JPG]] 

Make miniprep and digest with BamH1 + Sfi1 

  

== '''Result intepretation/Summary''' ==

== '''Conclusion''' ==

 

=== ===

 

== '''Cloning of 493-pLVXPlus2-App-IRES-mCherry''' ==

'''Purpose:''' Cloning of 493-pLVXPlus2-App-IRES-mCherry by PCR 

'''Date: '''2012-1-3

'''Notebook:'''

'''Page:'''

'''Clone ID:493'''

'''Experimenters:''' yingying

== '''Results''' ==

'''[[Image:475+493 PCR 1-4-2012.JPG]]''' 

method3:

App-Pme1-R    gctagagcGTTTAAACttagttctgcatctgctcaaag App-BamH1-F atcga ggatcc gcc acc atgctgcccagcctggcactg. Template          pCMV-SPORT6-App 305, use HiFi buffer 

[[Image:493 clone 1-4-2012.JPG]] 

{| cellspacing="1" cellpadding="1" border="1" style="width: 335px; height: 96px;"
|-
| 
| band 5 
| band 6 
|-
| 
| PCR product 
| pLVXPlus2-IRES-mCherry(174) 
|-
| digest enzyme 
| colspan="2" | BamH1 +Pme1 
|}

=== Subcloning ===

Date: 2011

 

=== Colony Screening ===

Date: 2012-1-6 

Make miniprep and digest with BamH1 +Pme1 

[[Image:493+528_digest_detect_1-6-2012.JPG]]

  

 

== '''Result intepretation/Summary''' ==

*Sequencing Result: 

== '''Conclusion''' ==

 

=== ===

 

[[Category:Cloning]]

493-pLVXPlus2-App-IRES-mCherry - Revision history

Yingying.lu at 19:28, 6 January 2012