https://eln.excellgen.com/index.php?action=history&feed=atom&title=683_pLysN-mKpn1 683 pLysN-mKpn1 - Revision history 2026-10-18T21:17:51Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=683_pLysN-mKpn1&diff=10519&oldid=prev Paul.xu at 16:37, 28 October 2013 2013-10-28T16:37:31Z <p></p> <p><b>New page</b></p><div>== &#039;&#039;&#039;Cloning of 683 pLysN-mKpn1&#039;&#039;&#039; ==<br /> <br /> &#039;&#039;&#039;Purpose:&#039;&#039;&#039; Cloning of 1683 pLysN-mKpn1 <br /> <br /> &#039;&#039;&#039;Date: &#039;&#039;&#039;2013-10-21--- <br /> <br /> &#039;&#039;&#039;Notebook:0&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Page:&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Clone ID:683&#039;&#039;&#039; <br /> <br /> &#039;&#039;&#039;Experimenters:&#039;&#039;&#039;&amp;nbsp; shanyi <br /> <br /> == &#039;&#039;&#039;Results&#039;&#039;&#039; ==<br /> <br /> === PCR ===<br /> <br /> PCR using pUS40-mKpn1 as template&lt;br&gt;mKpn1-Nde1-F ctagca catatggataatcatgctaacga&lt;br&gt;mKpn1-Xho1-R gtcgagctcgagctatattatttctatttttttata <br /> <br /> [[Image:683PCR.JPG]] <br /> <br /> digest with NdeI+XhoI <br /> <br /> [[Image:DIGEST FOR683.JPG]]&lt;br&gt;&lt;br&gt; <br /> <br /> === Colony Screening ===<br /> <br /> Date: 2013-10-23 <br /> <br /> Make miniprep, digest with NdeI+XhoI&lt;br&gt; <br /> <br /> [[Image:683 1715DIGEST.JPG]] <br /> <br /> SENT 683-8 TO SEQUENCE&lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> &lt;br&gt; <br /> <br /> == &#039;&#039;&#039;Result intepretation/Summary&#039;&#039;&#039; ==<br /> <br /> *&lt;br&gt;<br /> <br /> == &#039;&#039;&#039;Conclusion&#039;&#039;&#039; ==<br /> <br /> [[Category:Cloning]]</div> Paul.xu