https://eln.excellgen.com/index.php?action=history&feed=atom&title=832_pMiniT-VVTopo 2026-10-18T12:51:31Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=832_pMiniT-VVTopo&diff=16303&oldid=prev 2017-07-07T19:02:03Z

<p></p> <p><b>New page</b></p><div>6/23/2017<br /> <br /> colony PCR &amp;nbsp;screening<br /> <br /> [[File:832 pMiniT-VVTopo PCR Screening.JPG|RTENOTITLE]]<br /> <br /> 6/24/17<br /> <br /> Miniprep, digestion with EcoRV<br /> <br /> [[File:832 837 EcoRV digestion.JPG|RTENOTITLE]]<br /> <br /> <br /> <br /> [[File:837 832 miniprep PCR.JPG|RTENOTITLE]]<br /> <br /> 1, 3: PCR using NEB primers<br /> <br /> 2, 4, PCR using pMiniT-seq-F and pMiniT-seq-R<br /> <br /> <br /> <br /> 7/5/2017<br /> <br /> Fix clone using new primers<br /> <br /> remove extra ATG PCR from 832 using these two primers 831-F ATCCATATGCGTGCCCTGTTCTATAAAG<br /> <br /> 831-R CTGTCTAGAGTCGACGGTACCAAG (CTTGGTACCGTCGACTCTAGACAG) <br /> <br /> clone back into pMiniT 1.2<br /> <br /> miniprep digestion, EcoRV&amp;nbsp;<br /> <br /> [[File:832fix EcoRV cut.JPG]]<br /> <br /> Miniprep digestion with Nde1 + Xho1<br /> <br /> [[File:832fix Nde1 Xho1 cut.JPG]]<br /> [[Category:Cloning]]</div>

Paul.xu