https://eln.excellgen.com/index.php?action=history&feed=atom&title=944_pET30b-pfu-exo 2026-10-18T16:44:12Z Revision history for this page on the wiki MediaWiki 1.44.0 https://eln.excellgen.com/index.php?title=944_pET30b-pfu-exo&diff=17762&oldid=prev 2018-04-19T23:08:59Z

<p></p> <p><b>New page</b></p><div>== Date:4/5/2018 ==<br /> <br /> &#039;&#039;&#039;PCR of 944 F1+F2&#039;&#039;&#039;<br /> <br /> Template:367, cut out band then combine<br /> <br /> <br /> <br /> <br /> <br /> [[File:Pcr944F1+F2.JPG|RTENOTITLE]]<br /> <br /> <br /> <br /> PCR from 367 pEC-Pfu&amp;nbsp;&lt;br/&gt;1, fragment 1<br /> <br /> 944-Pfu-Exo-Nde1-F&lt;br/&gt;atcatcCATATGATTTTAGATGTGGATTAC<br /> <br /> &lt;br/&gt;944-Pfu-exo-R&lt;br/&gt;cgtgatagagggttGctatTtcgaaggcaagaatc<br /> <br /> Fragment 2<br /> <br /> 944-Pfu-exo-F&lt;br/&gt;gattcttgccttcgaAatagCaaccctctatcacg<br /> <br /> 944-Pfu-Exo-Xho1-R&lt;br/&gt;atcatcctcgagggattttttaatgttaagccag&lt;br/&gt;(ctggcttaacattaaaaaatccctcgag gatgat)<br /> <br /> 2, purify and join by PCR<br /> <br /> 944-Pfu-Exo-Nde1-F&lt;br/&gt;atcatcCATATGATTTTAGATGTGGATTAC<br /> <br /> 944-Pfu-Exo-Xho1-R&lt;br/&gt;atcatcctcgagggattttttaatgttaagccag&lt;br/&gt;(ctggcttaacattaaaaaatccctcgag gatgat)<br /> <br /> <br /> <br /> 3, digest with Nde1 -Xho1<br /> <br /> ligate into Nde1-Xho1 digested pET30b<br /> <br /> or ligate into pMiniT2 first</div>

Paul.xu