Paul.xu at 20:07, 21 June 2017

2017-06-21T20:07:51Z

New page

== pMiniT ==

1. Assemble reaction mix

Linearized pMiniT Vector (25 ng/µl),  1 µl (25 ng) PCR Insert* 4 µl*  Cloning Mix 1 (Buffer) 4 µl Cloning Mix 2 (Ligase) 1 µl 

Total Volume 10 µl

2. Incubate at room temperature (25°C) for 15 minutes.

3. Transform immediately (or store at –20°C)

4. Add 100 µl chemical competent cells, mix

5. Incubate on ice for 20  min.

6. Heat shock at 42°C for 30 seconds.

7. Chill on ice for 5 minutes.

8. Add 950 µl of SOC medium and place at 37°C for 60 minutes with rotation or shaking at 250 rpm

9. Spin down cells, 30 sec, max speed

10. Spread on LB/Amp plate

11. Incubate at 37 oC o/n

== pJet 1.2 ==

1. Assemble reaction mix

2X Reaction Buffer: 5 µL PCR product: 4 µL (0.15 pmol) pJET1.2/blunt Cloning Vector(50 ng/µL): 0.5 µL (0.025 pmol ends) T4 DNA Ligase 0.5 µL

Total volume 10 µL 2. Incubate at room temperature (25°C) for 15 minutes.

3. Transform immediately (or store at –20°C)

4. Add 100 µl chemical competent cells, mix

5. Incubate on ice for 20  min.

6. Heat shock at 42°C for 30 seconds.

7. Chill on ice for 5 minutes.

8. Add 950 µl of SOC medium and place at 37°C for 60 minutes with rotation or shaking at 250 rpm

9. Spin down cells, 30 sec, max speed

10. Spread on LB/Amp plate

11. Incubate at 37 oC o/n

== PCR Screening ==

=== Screening of clonies ===

1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes.

2. Pick  each individual colony, suspend in 5 ul H2O

3. Transfer 0.5~1 ul to PCR screening reaction mix

4. Add 500 ul LB/amp to the rest of  E coli suspension, grow at 37 oC or at room temperature

=== ===

=== Screening of culture ===

1.Aliquot  50 or 100 ul of LB/amp to 1.5 ml tubes.

2. Pick  each individual colony, suspend in medium

3.  Culture in an incubator at 37 oC  for 1 hour

4. Transfer 0.5 ul culture to PCR screening reaction mix

=== '''pJet1.2''' ===

1. Assemble PCR reaction mix '''Per reaction'''

 10X Taq buffer 1.5 µL  10 uM dNTP mix 0.5 µL pJET1.2 Forward Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-F2 catatccatccggcgtaatac pJET1.2 Reverse Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-R2 cagcctgaaaatcttgagag Water, nuclease-free 11 µL Taq DNA Polymerase 5 u/µL, 0.5 µL  Total volume 15 µL

2. Aliquot 14 ul to each tube.

3. Add 0.5 ul bacterial suspension from colony or culture

'''4. PCR''' 95 oC 3 min 25~ 30 cycles  of 95 oC 30 s 55 oC 30 s 72 oC 1 min per kb

72 oC 3 min

5. Add 5 ul 6X GRGreen Loading Dye 6. Run on 1% agarose gel

=== '''pMiniT''' ===

as pJet1.2, but use   these two oligos

pMiniT-seq-R TCAGGGTTATTGTCTCATGAGCG

pMiniT-seq-F ACCTGCCAACCAAAGCGAGAAC

== Restriction Enzyme Digestion ==

1. For PCR positive clones, transfer 10 ul culture to 5 ml LB/amp in 15 ml tube

2. Culture at 37 oC o/N in a shaker-incubator.

3. Spin down cells,

4, Add  250 ul P1, suspend cells by votexing for 1~2 min.

5. Add 250 ul P2. Mix gentely, let lysis for 1 min

6. Add 350 ul N3. Mix 

7. Transfer to 1.5 ml tube.

8, Spin 2 X 3 min.

9. Transfer supernatant to a miniprep column (column from China must be pretreated: soaked in 5 N NaOH for 30min, spin to remove NaOH from column)

10. Spin for 3 sec

11. Add 350 ul PB, spin, remove liquid

12. Add 700 ul PE, spin, remove liquid

13. Spin for 1 min at max speed

14. Add 50 ul EB or TE buffer, soak for 3 sec, 

15. Spin for 1 min at max speed

16. Check DNA quality and quantitate DNA concentration using nanodrop

'''Digestion'''

Use 5 ul miniprep for  digestion

1. make mix, per reaction

1.5 ul FastDigestion Buffer

0.3 ul enzyme 1

0.3 ul enzyme 2 (if required)

5 ul miniprep

H2O to 15 ul

2. Incubate at 37 oC  for 30 min in an incubator 

3. Add 5 ul 6X GRGreen loading buffer

4. Run on 1% agarose gel

5. Take a picture using blue light transilluminator 

6. Process gel picture and upload to ELN

7. Document all experimental details

== [[Category:Protocols]]Sequencing ==

[[Sequencing|Send positive clone to sequencing company]]

Blunt-end PCR Cloning - Revision history

Paul.xu at 20:07, 21 June 2017