Paul.xu at 18:39, 26 April 2017

2017-04-26T18:39:59Z

New page

== My protocol  ==

 1. Extract of total RNA In general, 0.5 µg to 1.0 µg total RNA is sufficient for the amplification of specific Ig variable regions by 5’-RACE. 

2. 1st strand synthesis using and MMLV reverse transcriptase

2490-mIgG2aHC-RT-R (gagctcagcacccacaaaac) gttttgtgggtgctgagctc

2 µg purified total RNA; 1 µg of appropriate constant region primer (2490-mIgG2aHC-RT-R) 5 µl 5× reaction buffer; 25 U RNasin Ribonuclease Inhibitor; 200 U M-MLV reverse transcriptase; 0.5 mM dNTP; Nuclease-free water

Before adding the rest of the reaction mixture, prepare the RNA and corresponding constant region primer in a separate tube, and heat to 70 °C for 10 min, to disrupt any RNA secondary structure that might have formed. After heating, place the tube immediately on ice to prevent secondary structure reforming. RNA can form very stable secondary structures that can markedly reduce the efficacy of reverse transcription. Add the rest of the reverse transcriptase mix to the tube, mix gently, spin down, and incubate at 42 °C for 60 min. 

 3. TdT tailing

Purify RT reaction by column.

Elute DNA with 50 ul H2O

Mix:

6.0 μl 10X TdT Buffer 6.0 μl 2.5 mM CoCl2 solution provided 50 μl 1st strand cDNA (~ 5.0 pmols DNA, i.e., 330 ng for 100 bp, 1 µg for 300 bp, 10 pmols DNA ends)* 1 μl 10 mM dATP  0.6 μl Terminal Transferase (20 units/μl)

*To determine approximate amount of DNA (ng/pmol), multiply the number of base pairs by 0.66. Example: 300 bp x 0.66 = 198 ng/pmol. For 5.0 pmols multiply by 5, resulting in 990 ng/5 pmol.

Incubate at 37°C for 30 minutes.

Cool on ice.

 Terminal Deoxyribonucleotide Transferase (Promega, Madison, WI, USA); dNTP (e.g. dATP) (Fermentas, Vilnius, Lithuania).  A homopolymeric tail is added to the 3’-end of the first-strand cDNA in a reaction that is catalysed by terminal deoxynucleotidyl transferase (TdT) using only one of the possible four dNTPs. Usually, 20-100 nucleotides are added to the DNA fragment in the tailing reaction, and these represent a primer binding site for second-strand synthesis. For addition of the poly(A) tail, prepare the following reaction mixture in a sterile microcentrifuge tube on ice, in a total reaction volume of 20 µl: 5-10 µl purified first-strand cDNA (the optimal amount depends on the amount of RNA used in the first-strand reaction and on the purification efficiency); 4 µl 5× reaction buffer; 150 pmol dATP (or any other dNTP); 30-40 U TdT; Nuclease-free water. Incubate for 1 h at 37 °C, and then for 10 min at 70 °C, to inactivate the enzyme. Place the tube on ice. Isolate the poly(A)-tailed cDNA with a DNA Purification kit. TdT buffer is not compatible with the PCR buffer system, therefore the tailed cDNA has to be purified before PCR. 

 2. Synthesis of second-strand cDNA and PCR amplification of the Ig variable-region sequence 

2494_IgG2a-HL-Const-R  constant  GGTCAAGGTGACTGGCTCAGGGAA (ttccctgagccagtcaccttgacc )

2494_IgG2a-HL-Const-BamH1-F

actagCTCGAGcatatgggatccTTTTTTTTTTTTTTTTT

Finally, the Ig-coding variable region is amplified in a PCR reaction using two primers: one complementary to the 5’-end (constant region) and the other complementary to the homopolymeric tail at the 3’-end of first-strand cDNA. Phusion HF polymerase is preferred for RACE, due to its lower error rate.

Prepare the following PCR reaction mixture, in a total reaction volume of 50 µl: 10 µl 5× reaction buffer;   0.2 µM constant region primer (e.g. constant region primer  2494_IgG2a-HL-Const-R  GGTCAAGGTGACTGGCTCAGGGAA ) 0.2 µM homopolymeric 2494_IgG2a-HL-Const-BamH1-F actagCTCGAGcatatgggatccTTTTTTTTTTTTTTTTT 0.2 µM dNTP mix; 2.5 U Phusion  polymerase; 1-5 µl purified tailed first-strand cDNA; Nuclease-free water. Incubate in a thermal cycler preheated to 95 °C, using the following conditions: Initial denaturation at 95 °C for 5 min, followed by 33 cycles of: 95 °C for 1 min; 55 °C for 1 min; 68 °C for 1 min. Incubate at 68 °C for 10 min, then cool to 4 °C and store at -20 °C. 

5. Clone into pMiniT vector

6. Sequencing

== Protocol 2 ==

based on this paper [http://onlinelibrary.wiley.com/doi/10.1016/S0014-5793(99)00649-3/full http://onlinelibrary.wiley.com/doi/10.1016/S0014-5793(99)00649-3/full]

2.2 Primer design

Two databases of 491 mouse heavy chain and 356 mouse light chain signal sequences, expanded from the Kabat database ([32], [http://immuno.bme.nwu.edu/ http://immuno.bme.nwu.edu/]), were used to design the PCR primers. Each signal sequence was assigned to a Vκ or a VH gene family [23,25], according to the related reference listed in the Kabat database. The signal sequences belonging to the same Ig gene family were aligned and the most conserved region was chosen to define consensus signal sequence primers as depicted on Tables 1 and 2. The antisense primer RevCκSalI (5′-CGACTA GTCGAC TGGTGGGAAGATGGATACAG-3′) contains the reverse complement of codons 113–120 of kappa light chain constant region. The following antisense oligonucleotides were designed to match the heavy chain constant regions: RevCγ1 SalI (5′-CGACAA GTCGAC TAGCCCTTGACCAGGCATCC-3′; matching codons 141–147 of Cγ1), RevCγ2a SalI (5′-CGACAA GTCGAC TAACCCTTGACCAGGCATCC-3′; matching codons 141–147 of Cγ2a), RevCγ2b SalI (5′-CGACTA GTCGAC CAGGGATCCAGAGTTCCAAG-3′; matching codons 156–166 of Cγ2b) and RevCγ3 SalI (5′-CGACTA TAGCCTTTGACAAGGCATCC-3′; matching codons 141–147 of Cγ3). These primers contained a SalI restriction site (underlined) for further cloning. The 5′-CG-3′ dinucleotide found in this restriction site is extremely rare in mammalian genomes [33] and the frequency of SalI recognition sites in variable domains of mouse antibodies is approximately 0.1–0.2%

Design PCR primers based on Table 1 and Table 2.

2.3 cDNA synthesis and PCR amplification of VH and Vκ genes from mouse hybridomas

Total RNA was extracted from 2×108 hybridoma cells using the TRIzol technique (Gibco BRL, Grand Island, NY, USA) as described by the manufacturer. 50 μg of total RNA was annealed at 65°C for 5 min with 10 pM of RevCκSalI primer for light chain cDNA synthesis or appropriate RevCγSalI primer for heavy chain cDNA synthesis in a 50 μl final volume of 1×first-strand cDNA synthesis buffer (Gibco BRL) containing 10 μM dNTPs (Gibco BRL) and 1 mM DTT (Gibco BRL). After annealing, the samples were cooled for 20 min at 20°C. 400 U of reverse transcriptase Superscript II (Gibco BRL) and 40 U of RNase inhibitor (Promega, Madison, WI, USA) were then added and the reaction was incubated for 1 h at 42°C. Reverse transcriptase activity was inactivated by incubation at 95°C during 5 min and cDNA was kept at −20°C until use. PCR amplification was carried out in a final volume of 20 μl containing 1 μl of cDNA synthesis reaction, 10 μM dNTPs, 2 μl of 10×PCR buffer (New England Biolabs, Beverly, MA, USA). '''Fourteen''' VH and '''18''' Vκ PCR reactions were set up using each group of family-specific 5′ primers (Tables 1 and 2) and the appropriate 3′-oligonucleotide probe matching the light or heavy chain constant region. Two mixtures, containing all VH or Vκ 5′ primers, were also set up. No PCR reaction was performed with primer specific for the VH13 (3609N) gene family since the only reported member assigned to this family is the non-functional allele of PC3609 [35]. The amount of each primer used was initially 10 pM for non-degenerated oligonucleotide and was increased two- to eight-fold depending on the degeneracy. The reaction mixtures were heated to 94°C for 10 min, then 2 U Vent DNA polymerase (New England Biolabs) was added and 30 cycles of amplification were carried out for 1 min at 94°C, 1 min at 55°C and 2 min at 72°C. After a 10 min extension at 72°C, the PCR products were fractionated through a 1.5% agarose gel (Gibco) and stained with ethidium bromide. Sets of 5′ primers and 3′ primers leading to a 390 bp product for Vκ amplification and a 450 bp product for VH amplification were selected from this family-specific PCR screening. Five replicates using the same selected primers were subjected to a new PCR as described above. The PCR-amplified DNA products were gel purified on a 1.5%, low melting temperature agarose gel (Gibco).

IgG2a

'''RT primers:'''

RevCγ2a SalI for IgG2A Heavy chain (5′-CGACAA GTCGAC TAACCCTTGACCAGGCATCC-3′; matching codons 141–147 of Cγ2a),

RevCκSalI for IgG2A light chain (5′-CGACTA GTCGAC TGGTGGGAAGATGGATACAG-3′)  

'''PCR Primers'''  IgG2A:

[http://www.protocol-online.org/forums/uploads/monthly_12_2010/msg-6759-075982100%201291964115.ipb http://www.protocol-online.org/forums/uploads/monthly_12_2010/msg-6759-075982100%201291964115.ipb]

Mouse heavy chain constant region primers

5 -gga aga tct CTT GAC CAG GCA TCC TAG AGT CA-3 </span

Mouse Light kappa chain constant region primer 

3' Kc: 5 -ggt gca tgc GGA TAC AGT TGG TGC AGC ATC-3

 

Mouse kappa chain FR1 region universal degenerate primer

'''L Chain'''

5' Mk is used as the 5' primer for the '''VL''' amplification 

Sense

5' Mk: 5 -gg gag ctc GAY ATT GTG MTS ACM CAR WCT  MCA-3

Antisense 

3' Kc: 5 -ggt gca tgc GGA TAC AGT TGG TGC AGC ATC-3

2486-TP4-mIgG2a-LC-VR-Xho1-R

(GCAGATGCTGCACCAACTGTATCC ctcgag atagca  )

tgctatctcgagGGATACAGTTGGTGCAGCATCTGC

2486-TP4-mIgG2a-LC-VR-EcoR1-F

tagaca gaattc GAY ATT GTG MTS ACM CAR WCT  MCA 

'''H Chain '''

An equimolar mixture of 5' MH1 and 5' MH2 as the 5' '''VH''' primer

Sense

5' MH1: 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG  TC-3 

5' MH2: 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG  TCW GG-3

2485-TP4-EcoR1-F1 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG  TC-3 

2485-TP4-EcoR1-F2 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG  TCW GG-3

Antisense

IgG2A: 5 -gga aga tct CTT GAC CAG GCA TCC TAG AGT  CA-3

 2485-TP4-Nhe1-Xho1-R

gtgcta ctcgag GCTAGC cttgaccaggcatcctagagtcac

(gtgactctaggatgcctggtcaag GCTAGC ctcgag tagcac)
[[Category:Protocols]] [[Category:Antibodies]]

Clone antibody from Hybridoma - Revision history

Paul.xu at 18:39, 26 April 2017