Paul.xu at 23:51, 20 September 2021

2021-09-20T23:51:01Z

New page

== IRES-Flpo mRNA from plasmid  ==

Product Cat #: EG-1045

Plasmid:  138 pMiniT2-T7-IRES-Flpo

<br/>Digest plasmid with EcoR1, purify 1933  bp fragment<br/>PCR using T7 and IVT-Flpo-R<br/>purify with column, elute with RNA-free water.

Use 1 ug as template for mRNA

T7 RNA Polymerase:

Storage Buffer: <br/>20 mM Tris-HC1 (pH 7.5) <br/>0.1 M NaCl <br/>0.1 mM EDTA <br/>1 mM DTT <br/>50% (v/v) glycerol <br/>0.01% (w/v) Triton® X-100  

5X T3/T7 RNA polymerase Buffer:<br/>0.2 M Tris-HCl (pH 8.0)<br/>40 mM MgCl2<br/>10 mM spermidine-(HCl)3<br/>125 mM NaCl

1X Buffer: 40 mM Tris-HCl (pH 8.0), 25 mM NaCl, 8 mM MgCl2 , 2 mM spermidine-(HCl)3 , 5 mM DTT

 0.4 mM ATP, 0.4 mM CTP, 0.4 mM GTP, 0.4 mM UTP, in 50 µl for 10 min. at 37°C.

== mRNA for transfection into mammalian cells ==

see [[In_vitro_transcription_using_PCR_product|In_vitro_transcription_using_PCR_product]] [[In_vitro_transcription_using_PCR_product|primers]]

== mRNA for in vitro transcription using  E coli lysate ==

=== Primers ===

Need to add  TAATACGACTCACTATAGGG to Forward Primer
<div>T7-NLS-FLPe</div><div>12_13_2012/D08</div><div>TAATACGACTCACTATAGGGATGGCCCCCAAGAAAAAGCGG</div><div><br/></div><div>FLPe-Xho-R</div><div>12_13_2012/D09</div><div>TAGTCGCTCGAGCTAGATCCGCCGGTTGATGTAG</div><div><br/></div><div>Flpe-Xba1-R</div><div>5_23_2014/A10</div><div>GCAGGCTCTAGACTAGATCCGCCGGTTGATGTAG</div><div>14:35, 10 September 2018 (EST)~</div><div><br/></div><div>T7-NLS-FLPo</div><div>12_13_2012/D07</div><div>TAATACGACTCACTATAGGGATGGCTCCTAAGAAGAAGAGG</div><div><br/></div><div>Flpo-Xho1-R</div><div>7_29_2013/C05</div><div>TGCTAGCTCGAGTCAGATCCGCCTGTTGATGTAG</div><div><br/></div><div>Flpo-PP7Pac-Xho1-R</div><div>3_20_2014/D05</div><div>GTCGTACTCGAGTAAGGGTTTCCATATAAACTCCTTATTAGATCCGCCTGTTGATGTAG</div><div><br/></div><div>3_20_2014/D05</div><div>Flpo-PP7Pac-Xho1-R</div><div>GTCGTACTCGAGTAAGGGTTTCCATATAAACTCCTTATTAGATCCGCCTGTTGATGTAG</div>
=== Template ===

==== Plasmid ====

plasmid DNA must be completely linearized with a restriction enzyme downstream of the insert to be transcribed.

PCR Templates: 100~ 500 ng of PCR fragments can be used in a 20 μl in vitro transcription reaction.

{| border="1" cellspacing="1" cellpadding="1" style="width:650px;"
|-
| ID
| Name
| ID
| Name
|-
| 471<br/>
| pAAV.CMV-FLPe<br/>
| 2378  <br/>
| pT7A3-Cre<br/>
|-
| <span style="color:#FF0000;">963</span><br/>
| <span style="color:#FF0000;">pMiniT2-Flpo</span><br/>
| <span style="color:#FF0000;">2364</span><br/>
| <span style="color:#FF0000;">pFastBac-oriP-Flpo-PDGFR-WPRE</span><br/>
|-
| 1445<br/>
| pCMV5-Gag-NLS-Flpe-WPRE-oriP<br/>
| 2354 <br/>
| pFastbac-GP64-Flpe-WPRE<br/>
|-
| <span style="color:#FF0000;">1981</span><br/>
| <span style="color:#FF0000;">pCMV5-Tat-Flpo-PDGFR</span><br/>
| 2353<br/>
| pFastbac-GP64-Flp-Flpe-WPRE<br/>
|-
| <span style="color:#FF0000;">1980  </span><br/>
| <span style="color:#FF0000;">pUltrabacM-6H-Tat-FLPo</span><br/>
| 2352 <br/><br/>
| pFastbac-GP64-Cre-Flpe-WPRE<br/>
|-
| 1969
| pCMV5-Gag-p2b-NLS-Flpe-WPRE-oriP<br/>
| <span style="color:#FF0000;">2320</span>
| <span style="color:#FF0000;">pFastBacDual-VSVG-Flpo</span><br/>
|-
| 1964
| pCMV5-n-NA-NLS-Flpe-WPRE-oriP<br/>
| 2109  <br/>
| pCMV-RSV-Gag-Flpe<br/>
|-
| <span style="color:#FF0000;">1962</span><br/>
| <span style="color:#FF0000;">pCMV5-HTN-Flpo</span><br/>
| <span style="color:#FF0000;">2122  </span><br/>
| <span style="color:#FF0000;">pCMV5-Mfge8-Tat-FLPo-MFGE8</span><br/>
|-
| <span style="color:#FF0000;">1952 </span><br/>
| <span style="color:#FF0000;">pT7A3-Tat-Flpo</span><br/>
| 2225
| pFastbacDual-VSVG-M-6H-Tat-Flp-MFGE8-Gag-Flpe<br/>
|-
| <span style="color:#FF0000;">1808 </span>
| <span style="color:#FF0000;">pT7A3-6His-NLS-Flpo</span><br/>
| 2226<br/>
| pFastBac-Dual-VSVG-HIVGag-FLPe<br/>
|-
| <span style="color:#FF0000;">1526  </span><br/>
| <span style="color:#FF0000;">pCDNA3.1-NLS-FLPo</span><br/>
| 2227
| pFastBac-Dual-VSVG-HIVGag-FLP-CD63-Flpe<br/>
|-
| 1525  <br/>
| pCDNA3.1-FLPe<br/>
| <br/>
| <br/>
|-
| 2410<br/>
| pFastBac-VSVG-CMV5-Flp<br/>
| <br/>
| <br/>
|}

=== Kits ===

HiScribe T7 High Yield RNA Synthesis Kit

=== RNA Synthesis Protocols ===

1. Thaw the necessary kit components, mix and pulse-spin in microfuge to collect solutions to bottom of tubes. Keep on ice.

2. If you are planning to run many reactions, it is convenient to prepare a master mix by combining equal volumes of the 10X reaction buffer and four ribonucleotide (NTP) solutions. Use 10 µl per reaction.

3. Assemble the reaction at room temperature in the following order:

'''This protocol is for DNA template with T7 promoter + IRES + GOI + polyA, such as Flp PCR product'''

{| border="1" cellspacing="1" cellpadding="1" style="width:500px;"
|-
| Components
| Vol
| Final Concentration/Amount
|-
| Nuclease-free water  <br/>
| X µl<br/>
| <br/>
|-
| 10X Reaction Buffer<br/>
| 2 µl <br/>
| <br/>
|-
| ATP (100 mM) <br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| GTP (100 mM)<br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| UTP (100 mM) <br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| CTP (100 mM) <br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| 10 mM final Template DNA <br/>
| X µl  <br/>
| 1 µg<br/>
|-
| T7 RNA Polymerase Mix<br/>
| 2 µl<br/>
| <br/>
|-
| Total reaction volume<br/>
| 20 µl <br/>
| <br/>
|}

4. Mix thoroughly, pulse-spin in microfuge. Incubate at '''37°C for 2 hours'''. The yield will not be compromised if the incubation temperature is within the range of 35–40°C.  For reactions with transcripts longer than 0.3 kb, 2 hour incubation should give you the maximum yield.

5. Optional: DNase treatment to remove DNA template. Standard reactions normally generate large amounts of RNA at concentrations up to 10 mg/ ml. As a result the reaction mixture is quite viscous. It is easier to perform DNase treatment after the reaction mixture is diluted. To remove template DNA, add 70 μl nuclease-free water, 10 μl of 10X DNase I Buffer, and 2 μl of DNase I (RNase-free), mix and incubate for 15 minutes at 37°C.

6. Spin columns can be used to remove unincorporated nucleotides, proteins and salts. Adjust the volume of the reaction mixture to 100 μl by adding 80 μl nuclease-free water, mix well. Purify the RNA by following the manufacturer’s instructions. Each reaction could produce up to 180 μg of RNA which may exceed column capacity thus requiring additional columns. 

7. A NanoDrop Spectrophotometer can read RNA concentrations from 10 ng/μl to 3000 ng/μl directly. For single-stranded RNA, 1 A260 is equivalent to RNA concentration of 40 μg/ml. The RNA concentration can be calculated as follows: A260 x dilution factor x 40 = __ μg/ml RNA

=== Capped RNA Synthesis ===

1. Make 20 mM GTP solution by combining 2 μl of 100 mM GTP and 8 μl of nuclease-free water. Extra 20 mM GTP can be stored at –20°C for future use.

2. Prepare cap analog at the concentration of 40 mM.

3. Assemble the reaction at room temperature in the following order: 

{| border="1" cellspacing="1" cellpadding="1" style="width: 500px;"
|-
| Components
| Vol
| Final Concentration/Amount
|-
| Nuclease-free water  <br/>
| X µl<br/>
| <br/>
|-
| 10X Reaction Buffer<br/>
| 2 µl <br/>
| <br/>
|-
| ATP (100 mM) <br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| GTP (20 mM)<br/>
| 2 µl <br/>
| 2 mM<br/>
|-
| Cap Analog (40 mM)<br/>
| 4 µl<br/>
| 8 mM<br/>
|-
| UTP (100 mM) <br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| CTP (100 mM) <br/>
| 2 µl <br/>
| 10 mM<br/>
|-
| 10 mM final Template DNA <br/>
| X µl  <br/>
| 1 µg<br/>
|-
| T7 RNA Polymerase Mix<br/>
| 2 µl<br/>
| <br/>
|-
| Total reaction volume<br/>
| 20 µl <br/>
| <br/>
|}

4, Mix thoroughly, pulse-spin and incubate at 37°C for 2 hours.

5. Purification using spin column and measure RNA concentration using nanodrop

{| border="1" cellspacing="1" cellpadding="1" style="width:500px;"
|-
| 3´-O-Me-m7 G(5´)ppp(5´)G RNA Cap Structure Analog<br/>
| S1411S/L<br/>
| 1/5 µmol <br/>
| $145<br/>
|-
| m7 G(5´)ppp(5´)A RNA Cap Structure Analog<br/>
| S1405S/L<br/>
| 1/5 µmol <br/>
| $151<br/>
|-
| G(5´)ppp(5´)A RNA Cap Structure Analog<br/>
| S1406S/L<br/>
| 1/5 µmol <br/>
| <br/>
|-
| G(5´)ppp(5´)G RNA Cap Structure Analog<br/>
| S1407S/L<br/>
| 1/5 µmol <br/>
| <br/>
|-
| m7G(5´)ppp(5´)G RNA Cap Structure Analog<br/>
| S1404S/L<br/>
| 1/5 µmol <br/>
| <br/>
|}

  

==  SAM-Flp mRNA ==

Template; 2895 T7-VEE-NLS-Flp

Digestion: Xba1, Mlu1 or PacI Restriction enzymes which generate blunt ends or 5’-overhangs are preferred. such as XhoI, EcoRV, XbaI, EcoRI, MluI

3’-overhangs have been reported to generate spurious transcripts

use Xba1 digested plasmid for transcription, not working
[[Category:Products]] [[Category:Protocols]]

FLP Recombinase mRNA - Revision history

Paul.xu at 23:51, 20 September 2021