Paul.xu: Created page with "== PCR Screening == === Screening of clonies === 1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes. 2. Pick each individual colony, suspend in 5 ul H2O 3. Transfer 0...."

2017-06-23T16:01:49Z

Created page with "== PCR Screening == === Screening of clonies === 1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes. 2. Pick each individual colony, suspend in 5 ul H2O 3. Transfer 0...."

New page

== PCR Screening ==

=== Screening of clonies ===

1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes.

2. Pick  each individual colony, suspend in 5 ul H2O

3. Transfer 0.5~1 ul to PCR screening reaction mix

4. Add 500 ul LB/amp to the rest of  E coli suspension, grow at 37 oC or at room temperature

=== ===

=== Screening of culture ===

1.Aliquot  50 or 100 ul of LB/amp to 1.5 ml tubes.

2. Pick  each individual colony, suspend in medium

3.  Culture in an incubator at 37 oC  for 1 hour

4. Transfer 0.5 ul culture to PCR screening reaction mix

=== '''pJet1.2''' ===

1. Assemble PCR reaction mix '''Per reaction'''

 10X Taq buffer 1.5 µL  10 uM dNTP mix 0.5 µL pJET1.2 Forward Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-F2 catatccatccggcgtaatac pJET1.2 Reverse Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-R2 cagcctgaaaatcttgagag Water, nuclease-free 11 µL Taq DNA Polymerase 5 u/µL, 0.5 µL  Total volume 15 µL

2. Aliquot 14 ul to each tube.

3. Add 0.5 ul bacterial suspension from colony or culture

'''4. PCR''' 95 oC 3 min 25~ 30 cycles  of 95 oC 30 s 55 oC 30 s 72 oC 1 min per kb

72 oC 3 min

5. Add 5 ul 6X GRGreen Loading Dye 6. Run on 1% agarose gel

=== '''pMiniT''' ===

as pJet1.2, but use   these two oligos

pMiniT-seq-R TCAGGGTTATTGTCTCATGAGCG

pMiniT-seq-F ACCTGCCAACCAAAGCGAGAAC

== Restriction Enzyme Digestion ==

1. For PCR positive clones, transfer 10 ul culture to 5 ml LB/amp in 15 ml tube

2. Culture at 37 oC o/N in a shaker-incubator.

3. Spin down cells,

4, Add  250 ul P1, suspend cells by votexing for 1~2 min.

5. Add 250 ul P2. Mix gentely, let lysis for 1 min

6. Add 350 ul N3. Mix 

7. Transfer to 1.5 ml tube.

8, Spin 2 X 3 min.

9. Transfer supernatant to a miniprep column (column from China must be pretreated: soaked in 5 N NaOH for 30min, spin to remove NaOH from column)

10. Spin for 3 sec

11. Add 350 ul PB, spin, remove liquid

12. Add 700 ul PE, spin, remove liquid

13. Spin for 1 min at max speed

14. Add 50 ul EB or TE buffer, soak for 3 sec, 

15. Spin for 1 min at max speed

16. Check DNA quality and quantitate DNA concentration using nanodrop

'''Digestion'''

Use 5 ul miniprep for  digestion

1. make mix, per reaction

1.5 ul FastDigestion Buffer

0.3 ul enzyme 1

0.3 ul enzyme 2 (if required)

5 ul miniprep

H2O to 15 ul

2. Incubate at 37 oC  for 30 min in an incubator 

3. Add 5 ul 6X GRGreen loading buffer

4. Run on 1% agarose gel

5. Take a picture using blue light transilluminator 

6. Process gel picture and upload to ELN

7. Document all experimental details

== Sequencing ==

[http://excellgen.net/eln/Sequencing Send positive clone to sequencing company]
[[Category:Protocols]]

PCR Screening and Restriction Digestion - Revision history

Paul.xu: Created page with "== PCR Screening == === Screening of clonies === 1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes. 2. Pick each individual colony, suspend in 5 ul H2O 3. Transfer 0...."