Paul.xu at 14:39, 15 March 2017

2017-03-15T14:39:17Z

New page

== Protocol for harvesting pfu-sso7d (aka Phusion) polymerase ==

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

Glycerol stock of EQ458 E. coli cells The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony. LB medium. Link to LB recipe Chloramphenicol stock. Link to Cam recipe Kanamycin stock. Link to Kan recipe Refrigerated centrifuge. Spectrophotometer and cuvettes. French press. Georgiou lab, MBB, 3.310, ask before using. IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C. Disposable plastic columns. ThermoSci, cat #29922 Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

50 mM NaH2PO4 300 mM NaCl 10mM Imidazole Adjust pH to 8.0 using NaOH

Wash Buffer:

50 mM NaH2PO4 300 mM NaCl 40mM Imidazole Adjust pH to 8.0 using NaOH

Elution Buffer:

50 mM NaH2PO4 300 mM NaCl 250 mM Imidazole Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters 

50% Glycerol 100 mM Tris/HCl pH 8.0 0.2 mM EDTA 0.2% NP-40; nonionic detergent 0.2% Tween20 2 mM DTT (add immediately before use)

IMPORTANT: Add fresh DTT immediately before use by freshly dissolving it from powder or from a 1 M stock stored at –20°C. We have observed rapid loss of function of enzyme when it is diluted in old storage buffer that has been stored at room temperature.

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.

Day –2: Precondition

Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.

Day –1: Induce

Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.

Day 0: Harvest

Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins. Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette. French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure. Collect and reintroduce into french press 1x. Heat denature at 70°C for about 15 mins. Spin down, 10,000 x g for 30 mins. Syringe filter the supernatant (0.22 µm filter). Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel

Prepare a 1 mL Ni-NTA resin column. Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice. Bind with 1:1 lysis buffer:SN sample. Wash with 1x column volume of lysis buffer. Wash with 5x (column volume) of wash buffer. Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

Place dialysis cassette into storage buffer for 2 mins. Remove top and load dialysis cassette with enzyme sample using a pipette or syringe. Squeeze the membrane to remove excess air. Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate. Allow to sit for 2 to 4 hours. Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight. If cassette has swollen, use syringe to remove some of the sample. Open top of cassette and remove sample. Store at –20°C.

Assay purified phusion polymerase activity by PCR

*IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.

Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase. To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock. NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp) Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044 Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968 Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957 Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547 Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul Water 12.4 dNTP (10mM) 0.4 5x buffer 4 Primer F (10uM) 1 Primer R (10uM) 1 Template (2ng/ul) 1 Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs) Initial denaturation 98 30s Denaturation 98 10s Annealing 69 20s Extension 72 30s / kbp Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5 Phusion dilution 25 50 100 NEB (neat) H20

Limitations of purified polymerase

To date, we have noted reduced processitivity of longer transcripts (>4kb) using our purified polymerase compared to the commercial variant.

[7kb_4kb.pdf]

== Pfu Buffer ==

10 mM KCl

10 mM (NH4)2SO4

20 mM Tris-HCl, pH 8.8

2 mM MgSO4

0.1% Triton X-100

100 ug/ml BSA

'''Herculase PCR Buffer'''

50 mM Tricine, pH 9.1

8 mM (NH4)2SO4

2.3 mM MgCl2

0.1% Tween-20

75 ug/ml BSA

For PCR, add 2 U of Pfu dUTPase, 5 U Pfu/Phusion

'''Taq Buffer'''

10 mM Tris-HCl (pH 8.8)

50 mM KCl

2 mM MgCl2

0.1% Triton X-100

'''Buffer from websites'''

1. 10X Taq Buffer with KCl 100mM Tris-HCl (pH 8.8 at 25 °C), 500mM KCl, 0.8% Nonidet P40. 2. 10X Taq Buffer with KCl and 15mM MgCl2 100mM Tris-HCl (pH 8.8 at 25 °C), 500mM KCl, 0.8% Nonidet P40, 15mM MgCl2. 3. 10X Taq Buffers with KCl Set 100mM Tris-HCl (pH 8.8 at 25 °C), 500mM KCl, 0.8% Nonidet P40, MgCl2 different in each buffer (12.5-30mM) 4. 10X Taq Buffer with (NH4)2SO4 750mM Tris-HCl (pH 8.8 at 25 °C), 200mM (NH4)2SO4, 0.1% Tween 20. 5. 10X Taq Buffer with (NH4)2SO4 and 20mM MgCl2 750mM Tris-HCl (pH 8.8 at 25 °C), 200mM (NH4)2SO4, 0.1% Tween 20, 20mM MgCl2. 6. 10X Taq Buffer without Detergent 100mM Tris-HCl (pH 8.8 at 25 °C), 500mM KCl. 7. 10X Pfu Buffer with 20mM MgSO4 200mM Tris-HCl (pH 8.8 at 25 °C), 100mM (NH4)2SO4, 100mM KCl, 1% (v/v) Triton X-100, 1mg/ml BSA and 20mM MgSO4. 8. 10X Pfu Buffer 200mM Tris-HCl (pH 8.8 at 25 °C), 100mM (NH4)2SO4, 100mM KCl, 1% (v/v) Triton X-100, 1mg/ml BSA.



References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Phusion Polymerase - Revision history

Paul.xu at 14:39, 15 March 2017