https://eln.excellgen.com/index.php?action=history&feed=atom&title=Promoter_sequences
Promoter sequences - Revision history
2026-10-19T08:30:39Z
Revision history for this page on the wiki
MediaWiki 1.44.0
https://eln.excellgen.com/index.php?title=Promoter_sequences&diff=18719&oldid=prev
Paul.xu: Created page with "<parsererror style="display: block; white-space: pre; border: 2px solid #c77; padding: 0 1em 0 1em; margin: 1em; background-color: #fdd; color: black"> === This page contains..."
2018-07-14T02:26:27Z
<p>Created page with "<parsererror style="display: block; white-space: pre; border: 2px solid #c77; padding: 0 1em 0 1em; margin: 1em; background-color: #fdd; color: black"> === This page contains..."</p>
<p><b>New page</b></p><div><parsererror style="display: block; white-space: pre; border: 2px solid #c77; padding: 0 1em 0 1em; margin: 1em; background-color: #fdd; color: black"><br />
=== This page contains the following errors: ===<br />
<div style="font-family:monospace;font-size:12px">error on line 1 at column 676: attributes construct error </div><br />
=== Below is a rendering of the page up to the first error. ===<br />
</parsererror><br />
{| border="1" cellspacing="1" cellpadding="1" style="width:500px;"<br />
|-<br />
| Promoter<br />
| Sequence<br />
| Example&nbsp;<br />
| <br/><br />
| <br/><br />
|-<br />
| T7<br />
| <span style="font-family:courier new,courier,monospace;">TAATACGACTCACTATA<u>G</u>GGGAA</span><br/><br />
| <br/><br />
| <br/><br />
| <br/><br />
|-<br />
| T7C4<br />
| <span style="font-family:courier new,courier,monospace;">TAATACGACTCACTATCAAGGAA</span><br />
| taatacgactcactatcaaggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatatacatatg<br/><br />
| <br/><br />
| <br/><br />
|-<br />
| T7H10<br/><br />
| <br />
|}</div>
Paul.xu