Paul.xu at 21:47, 22 March 2012

2012-03-22T21:47:48Z

New page

'''Tn5 Transposase Production'''

Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit. 

== Materials ==

*pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen) * BL21(DE3)pLysS cells * TEGX buffer o 10 mM Tris-HCl pH 7.5 o 700 mM NaCl o 1 mM EDTA o 10% glycerol o 0.1% Triton X-100

 * Storage buffer (Epicentre) o 50% glycerol o 50 mM Tris-HCl pH 7.5 o 100 mM NaCl o 0.1 mM EDTA -- our version has 5 mM EDTA, since we never want in-vitro action o 1 mM DTT

 

== Protocol ==

*Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight o Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin * Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium. * Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5 * Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours * Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes * Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor * Sonicate 3x pausing 10 minutes between sonications with the cells on ice * Centrifuge at 4C to remove cell debris - 1 hour at 16,000 x g * Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads) * Wash the column with 100 ml cold TEGX buffer * Load the cell supernatent onto the column and allow it to flow through * Flow the supernatent past the column a second time * Wash the column with 200 ml TEGX buffer * Add 1 ml of 1M DTT to 20 ml of TEGX buffer * Flow the 21 ml DTT + TEGX into the column * Cap the column and hold at 4°C overnight * Recover the protein with 10 ml TEGX buffer flowed through the column * Recover a second 10 ml similarly * Concentrate the protein by spinning in Centricon YM10 * Dilute concentrate with 40% glycerol to bring final to 50% * Store aliquots at -80 and -20 * Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use

 

== Molarity ==

*Gel runs at 55 KD, approximately correct for a 450 AA protein. * Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 - 2.5 pmol * 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng * 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug * 100 fmol transposon = 180 ng

 

== DNA binding tests ==

*Use constant 200 ng of DNA (dilute from 1 ug/ul stock) * Use serial dilutions of protein starting at 8 ug/ul o 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA * Incubate 30 minutes at 37 * Run on 0.8% E-Gel * DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX

 Tests

 o 2 ul 116 ng/ul ME0 PCR DNA o 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer o incubate 1 hour 37C o overnight at 4C

Gel images 

 

*Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C o this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase o Concentrated to 20 ul and run on a 1.2% gel * 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C o this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess

DNA binding and cutting tests

*0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume o done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA o incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer) o results: near linear increase of cut out fragments with transposase molar excess of 0-9x

 

Standard Epicentre reaction

 

*1 ul DNA (100 ng/ul) in TE * 2 ul transposase * 1 ul glycerol * This is: o about 100 fmol or less transposon DNA o at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess o 25 ng/ul final, so expect 1e4 or so transformants

To Do

*Prep new Tn5 protein (on hold, unnecessary) * quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct) * Make storage buffer, dilute existing stock into storage buffer (done) * run  style test of transposome formation (to do; initial gel unconvincing) * Run  style test of transposon cutting (to do) * Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

 pWH1891 Sequence information

*T7 and Intein-R primers, ATG start at 45 * Truncates aa's 1-4 from canonical sequence * Mutations o E54K -- improve binding to OE o M56A -- eliminate start for C-terminal inhibitory protein o L372P -- hyperactive mutation

>pWH1891 CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT TAATGGCGGATGGGTCTATGA

 Testing the transposase

*Transform 50 μl of E. coli Top10 electrocompetent cells with: o Tn5 transposons (1 μl); plate out on Tet plates, count colonies o pUC19 positive control 10 pg/μl; plate out on amp plates o Electroporation at 2.5 KV in 2 mm gap cuvette o pUC19 colonies visible in six hours under the microscope o Tet resistant colonies are not visible at that time

 Notes

*uses 100 mM hydroxylamine as a cleavage reagent instead of DTT

 

[[Category:Protocols]]

Tn5 Transposase - Revision history

Paul.xu at 21:47, 22 March 2012