Paul.xu: moved VP16 Cloning to VP16

2011-05-06T23:24:25Z

New page

[http://eln/eln/images/0/04/PVp16-1.txt Design of VP16 for gene synthesis]

 VP16-pET28b, Digestion with Nde1+ Xho1 or Nco1+ Xho1 should yield 1489bp fragment

miniprep from 8 colonies

[[Image:IMG 0156.JPG]]

Digest DNA with Nde1+ Xho1, Fermentas 

[[Image:IMG 0157.JPG]] 

Digest DNA with Nco+ Xho1, Fermentas

[[Image:IMG 0158.JPG]]

Digest DNA with Nde1+ Xho1, NEB

 

plasmid from clone 1, 2 and 8

[[Image:IMG 0159.JPG]]

Digest with Nde1+Xho1 (Fermentas)+AseI using FastDigest buffer 

 Should yield 660bp, 829bp fragments

 

==

 

[[Image:VP16 Xho Xba.JPG]]

Plasmid 1 (lane 1, 2, 7), 2 (Lane 3, 4, 8),  8 (Lane 5, 6 9),  digested with Xho1 (lane 1, 3 5), or Xho1+Xba1 (Lane 2, 4, 6), or undigested (lane 7, 8, 9). Size are not right --[[User:Paul.xu|Paul.xu]] 22:14, 25 October 2010 (EST)

 

[[Image:Vp16-pET28b PCR Screening.jpg]] 

Vp16-pET28b colony PCR screening using T7F + Vp16-36

--[[User:Paul.xu|Paul.xu]] 11:13, 26 October 2010 (EST)

 

[[Image:VP16 pET28b PCR Screening 2.jpg]] 2nd PCR screening of VP16-pET28b

[[Image:Vp16-pET28b PCR Screening 2.jpg]]

re-run sample

 

--[[User:Paul.xu|Paul.xu]] 16:54, 26 October 2010 (EST)

[[Image:Vp16 pET28 Nde1 Xho1.jpg]]

Digest VP16-pET28 miniprep DNA with Nde1 + Xho1 

--[[User:Paul.xu|Paul.xu]] 12:18, 27 October 2010 (EST)

 

Sequencing result:

clone 24 is good, although the Nde1 site is not good (not digested completely).

 

align with pET28b pET28b        CCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGG Clone #24    CCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCG     AAAAACATATGG 

Need to subclone into Nde1+Xho1 digested pET28b & pDB.His.MBP. 

note: vp16-pET28b-20-T7-Term_R.ab1 & vp16-pET28b-20-T7-Term_R.seq are acutually clone 28 (not clone 20). Clone 28 is good, but has not been sequenced with T7. 

--[[User:Paul.xu|Paul.xu]] 12:19, 29 October 2010 (EST)

 

[[Image:VP16 pET28b Clone24 Nde1 Xho1 NEB Fastdigest.JPG|84x257px|VP16 pET28b Clone24 Nde1 Xho1 NEB Fastdigest.JPG]]

Digest VP16-pET28b (clone 24) with Nde1+Xho1 (left: FastDigest, Right: NEB). Cut out insert, sub clone into pET28b and pDB.His.MBP.

 

 After sublconing, (Nde1+Xho1 to cut insert, clone into pET28b and pDBHis.MBP), make miniprep and digest with Nde1+Xho1, or Nco1+ Xho1 : 

 

[[Image:VP16 pET28b pDBHisMBP Nde1 Xho1 NEB.JPG]] 

Digest with Nde1+ Xho1 (NEB enzymes). 

[[Image:VP16 pET28b pDBHisMBP Nde1 Xho1.JPG]][[Image:VP16 pET28b pDBHisMBP Nco Xho1.JPG]] 

Lane 1, 2, 3, 4: Vp16-pDB.His.MBP 

Lane 5, 6, 7, 8: vP16-pET28b 

Left: digest with Nde1+ Xho1 (FastDigest), Right: digest with Nco1+Xho1 (NEB) 

Positive clones: 3,4: VP16-pDBHis.MBP; 5,6,7,8: VP16-pET28b

 --[[User:Paul.xu|Paul.xu]] 18:59, 31 October 2010 (EST)

[[Image:VP16_pDB_His_GST_pDB_His_NusA_Nde1_Xho1.JPG]]

Lane 1, 2, 3, pDBHisGST-VP16; Lane 4, 5, 6, pDBHis.NusA-VP16
 
 

pDB.His.GST-Vp16 & pDB.His.NusA, digest with Nde1 + Xho1 

--[[User:Paul.xu|Paul.xu]] 17:20, 8 November 2010 (EST)

[[Category:Cloning]] [[Category:Protein_Expression]]

VP16 - Revision history

Paul.xu: moved VP16 Cloning to VP16