Editing Clone antibody from Hybridoma (section)

== My protocol&nbsp; ==

<br/>1. Extract of total RNA In general, 0.5 µg to 1.0 µg total RNA is sufficient for the amplification of specific Ig variable regions by 5’-RACE.&nbsp;

2. 1st strand synthesis using and MMLV reverse transcriptase

2490-mIgG2aHC-RT-R<br/>(gagctcagcacccacaaaac)<br/>gttttgtgggtgctgagctc

2 µg purified total RNA;<br/>1 µg of appropriate constant region primer (2490-mIgG2aHC-RT-R)<br/>5 µl 5× reaction buffer;<br/>25 U RNasin Ribonuclease Inhibitor;<br/>200 U M-MLV reverse transcriptase;<br/>0.5 mM dNTP;<br/>Nuclease-free water

Before adding the rest of the reaction mixture, prepare the RNA and corresponding<br/>constant region primer in a separate tube, and heat to 70 °C for 10 min, to disrupt any RNA<br/>secondary structure that might have formed. After heating, place the tube immediately on ice<br/>to prevent secondary structure reforming. RNA can form very stable secondary structures that<br/>can markedly reduce the efficacy of reverse transcription. Add the rest of the reverse<br/>transcriptase mix to the tube, mix gently, spin down, and incubate at 42 °C for 60 min.&nbsp;

<br/>3. TdT tailing

Purify RT reaction by column.

Elute DNA with 50 ul H2O

Mix:

6.0 μl 10X TdT Buffer<br/>6.0 μl 2.5 mM CoCl2 solution provided<br/>50 μl 1st strand cDNA (~&nbsp;5.0 pmols DNA, i.e., 330 ng for 100 bp, 1 µg for 300 bp, 10 pmols DNA ends)*<br/>1 μl 10 mM dATP&nbsp;<br/>0.6 μl Terminal Transferase (20 units/μl)



*To determine approximate amount of DNA (ng/pmol), multiply the number of base pairs by 0.66. Example: 300 bp x 0.66 = 198 ng/pmol. For 5.0 pmols multiply by 5, resulting in 990 ng/5 pmol.

Incubate at 37°C for 30 minutes.

Cool on ice.

<br/>Terminal Deoxyribonucleotide Transferase (Promega, Madison, WI, USA);<br/>dNTP (e.g. dATP) (Fermentas, Vilnius, Lithuania).&nbsp;<br/>A homopolymeric tail is added to the 3’-end of the first-strand cDNA in a reaction that is<br/>catalysed by terminal deoxynucleotidyl transferase (TdT) using only one of the possible four<br/>dNTPs. Usually, 20-100 nucleotides are added to the DNA fragment in the tailing reaction,<br/>and these represent a primer binding site for second-strand synthesis.<br/>For addition of the poly(A) tail, prepare the following reaction mixture in a sterile<br/>microcentrifuge tube on ice, in a total reaction volume of 20 µl:<br/>5-10 µl purified first-strand cDNA (the optimal amount depends on the amount of RNA<br/>used in the first-strand reaction and on the purification efficiency);<br/>4 µl 5× reaction buffer;<br/>150 pmol dATP (or any other dNTP);<br/>30-40 U TdT;<br/>Nuclease-free water.<br/>Incubate for 1 h at 37 °C, and then for 10 min at 70 °C, to inactivate the enzyme. Place<br/>the tube on ice. Isolate the poly(A)-tailed cDNA with a DNA Purification kit. TdT buffer is<br/>not compatible with the PCR buffer system, therefore the tailed cDNA has to be purified<br/>before PCR.&nbsp;

<br/>2. Synthesis of second-strand cDNA and PCR amplification of the Ig variable-region sequence&nbsp;



2494_IgG2a-HL-Const-R&nbsp;<br/>constant&nbsp;<br/>GGTCAAGGTGACTGGCTCAGGGAA<br/>(ttccctgagccagtcaccttgacc )

2494_IgG2a-HL-Const-BamH1-F

actagCTCGAGcatatgggatccTTTTTTTTTTTTTTTTT

Finally, the Ig-coding variable region is amplified in a PCR reaction using two primers:<br/>one complementary to the 5’-end (constant region) and the other complementary to the<br/>homopolymeric tail at the 3’-end of first-strand cDNA. Phusion HF polymerase<br/>is preferred for RACE, due to its lower error rate.

Prepare the following PCR reaction mixture, in a total reaction volume of 50 µl:<br/>10 µl 5× reaction buffer;<br/>&nbsp;<br/>0.2 µM constant region primer (e.g. constant region primer &nbsp;2494_IgG2a-HL-Const-R &nbsp;GGTCAAGGTGACTGGCTCAGGGAA )<br/>0.2 µM homopolymeric 2494_IgG2a-HL-Const-BamH1-F actagCTCGAGcatatgggatccTTTTTTTTTTTTTTTTT<br/>0.2 µM dNTP mix;<br/>2.5 U Phusion &nbsp;polymerase;<br/>1-5 µl purified tailed first-strand cDNA;<br/>Nuclease-free water.<br/>Incubate in a thermal cycler preheated to 95 °C, using the following conditions:<br/>Initial denaturation at 95 °C for 5 min, followed by 33 cycles of:<br/>95 °C for 1 min;<br/>55 °C for 1 min;<br/>68 °C for 1 min.<br/>Incubate at 68 °C for 10 min, then cool to 4 °C and store at -20 °C.&nbsp;

5. Clone into pMiniT vector

6. Sequencing