Editing GoldenGate TALEN Assembly (section)

== Materials  ==

=== '''Reagents''' <br>  ===

A) Set of 60 library vectors<br>B) 10X T4 DNA ligase buffer (NEB)<br>C) Quick ligase or T-4 DNA ligase (NEB)<br>D) restriction endonuclease BsaI (NEB)<br>E) restriction endonuclease Esp3I (Fermentas or Fisher [FERER0452])<br>F) Plasmid-Safe nuclease (Epicentre Biotechnologies E3110K )<br>G) 10mM ATP<br>H) chemically competent cells<br>I) SOC<br>J) LB plates and liquid media with Tetracycline (10mg/l), Spectinomycin (50mg/l),<br>Ampicillin (50mg/l)<br>K) X-gal/IPTG<br>L) Miniprep kit (Qiagen)<br><br> 

=== '''Primers'''  ===

For screening/sequencing of transformants:<br><br>pCR8_F1: ttgatgcctggcagttccct<br>pCR8_R1: cgaaccgaacaggcttatgt<br>TAL_F1: ttggcgtcggcaaacagtgg<br> 

Day3<br><br>Mini prep Miniprep the plasmids: Use enzymes AflII and XbaI to digest<br><br>TAL_R2: ggcgacgaggtggtcgttgg<br>SeqTALEN_5-1 catcgcgcaatgcactgac (use this for sequencing in place of TAL_F1)<br><br> 

=== '''Restriction endonucleases'''  ===

– for restriction screening (NEB)<br>AflII<br>XbaI<br>BstAPI or StuI<br>AatII<br>BspEI<br><br>