Editing NGS Library Preparation (section)

== Fragmentase&nbsp; ==

NEBNext dsDNA Fragmentase is com-posed of endonucleases isolated from two different E. coli sources: one construct expresses a fusion protein consisting of E. coli maltose binding pro-tein and Vibrio vulnificus nuclease mutant protein; the other expresses a fusion protein consisting of maltose binding protein and T7 endonuclease mutant protein.

Enzymatic methods to shear DNA into small pieces include DNAse I, a combination of maltose binding protein (MBP)-T7 Endo I and a non-specific nuclease Vibrio vulnificus (Vvn), NEB’s (Ipswich, MA) Fragmentase and Nextera tagmentation technology (Illumina, San Diego, CA)

Both enzymes are MBP-fusion

Periplasmic nuclease Vvn [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC169050/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC169050/]

Clone ID 942

T7 Endo 1

Clone ID: 941 pT7A3-pMBP-T7-Endo-1,&nbsp;1225 pET28b-T7-Endo1 <--- not going to work



[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1277808/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1277808/]

patent:&nbsp;8048664



Making a stable single catalytic domain of T7 Endo I T7 Endo I is a symmetrical homodimer. It consists of two catalytic domains connected by a β-sheet bridge. Each domain is comprised of residues 17–44 from one subunit and residues 50–145 from other subunit (6). Initial attempts were made to produce a SCD protein as a heterodimer of an N-terminal part (residues 1–46) and a C-terminal part (residues 47–149) of T7 Endo I by co-expression of separately-translated fragments. A second approach was made to fragment the full-length homodimer into two parts by introducing a protease (Genenase) cleavage site (P46H, A47Y) into the center of β-bridge of the full-length enzyme followed by cleavage of the purified mutant enzyme with Genenase. Neither approach resulted in a stable SCD protein dimer. The failure to directly produce this SCD protein might be due to instability of the heterodimeric SCD lacking the stabilizing bridge of the full-length enzyme.

In order to facilitate folding of SCD into a stable heterodimer, we added a dimerization functionality to the separately-translated catalytic-domain fragments. This approach employed a trans-splicing intein system from the DnaE gene of Synechocystis sp. PCC6803 (10). This system is known to mediate tight association of fusion partners, sufficient to restore catalytic activity to separated enzyme domains.



The experimental procedure is illustrated in Figure 1A. Briefly, two expression plasmids, pMEn-In and pIc-Ec, were constructed as described in Materials and Methods. The two plasmids were used to produce two polypeptides MEn–In and Ic–Ec. Ic–Ec was insoluble when expressed in E.coli. A soluble form of Ic–Ec was obtained by refolding the polypeptide in vitro. For assembly and purification of SCD protein, MEn–In/Ic–Ec, MEn–In was first bound to an amylose column followed by passage of excess amounts of soluble Ic–Ec through the column. After washing out the unbound Ic–Ec, the dimeric SCD protein MEn–In/Ic–Ec was eluted from the column with maltose buffer.





Recombinant DNA and mutagenesis DNA manipulation was performed as described in Molecular Cloning by Sambrook et al. (11). Site-directed mutagenesis by two-step PCR was described previously (9). For generating En–In gene fusion by two-step PCR, two template plasmids pEndo I (9) and pMEB2 and the following four primers were used: oligo-1, GCCGAATTCATGGCAGGTTACGGCGCTAAAGGAATC; oligo-2, TTCGGTACCAAAAGACAGGGCATTGCTCGCCGGAATTAC; oligo-3, GTAATTCCGGCGAGCAATGCCCTGTCTTTTGGTACCGAA; and oligo-4, CCCGGAAGCTTATTTAATTGTCCCAGCGTCAAGTAATGG.

In the first step PCR plasmid pEndo I, oligo-1 and oligo-2 were used for generating the N-terminal part (En) coding sequence of T7 Endo I; pMEB2, oligo-3 and oligo-4 were used for generating the N-terminal part (In) coding sequence of the trans-splicing intein. The first cysteine of In was changed to alanine to prevent autoproteolysis of the desired SCD protein (10). In the second PCR step, the En–In gene fusion was assembled by using the two products (En and In) of the first PCR step as templates, oligo-1 and oligo-4 as primers. The Ic–Ec gene fusion was generated in a similar way. Plasmid pKEB12; oligo-5, ATAGACCATGGTTAAAGTTATCGGTGCTAGATCTCTGGGC; and oligo-6, AATGCTCGCCGGAATTACGTTAGCTGCGATAGCGCC, were used for generating the C-terminal portion (Ic) coding sequence of intein. Plasmid pEndo I; oligo-7, GGCGCTATCGCAGCTAACGTAATTCCGGCGAGCAAT; and oligo-8, GGCCGCTGCAGTTATTTCTTTCCTCCTTTCCTTTTTAATCT, were used for generating the C-terminal portion (Ec) coding sequence of T7 Endo I. The Ic–Ec gene fusion was assembled by PCR using both products (Ic and Ec) of the first PCR step as templates and oligo-5 and oligo-8 as primers. Expression plasmid pMEn–In which contained the coding sequence for MBP–En–In protein fusion, named MEn–In, was constructed by inserting the En–In coding sequence into the EcoRI–HindIII site of pMAL-c2x after being digested with the same restriction enzymes. Expression plasmid pIc-Ec was constructed by replacing the DNA between the NcoI and PstI sites of pKEB12 with the Ic–Ec coding sequence after being digested with the same restriction enzymes. All cloned DNA was verified by DNA sequence analysis.

For purification of unfolded insoluble protein Ic–Ec or Ic–Ec(∇9), cells from one liter of culture were harvested and lysed by sonication in 50 ml of sonication buffer (10 mM Tris, pH 7.6, 50 mM NaCl and 1 mM EDTA). The insoluble pellets were saved, washed with 100 ml of high salt buffer (1.0 M NaCl) once, 100 ml distilled water twice, 100 ml 0.5% Triton X-100 twice, 100 ml distilled water twice, and then with 100 ml of sonication buffer. The pellets were saved and dissolved in 40 ml of 6 M guanidine hydrochloride containing 20 mM Tris, pH 7.6, 50 mM NaCl, 20 mM DTT and 1 mM EDTA. The solution, after clearing by centrifugation (14 000 r.p.m., JA-17 rotor, 20 min), was dialyzed against 500 ml of refolding buffer (20 mM Tris, pH 7.6, 50 mM NaCl, 2 mM DTT and 1 mM EDTA) with four changes at 4°C. The refolded soluble protein and unfolded precipitates were separated by centrifugation (12 000 r.p.m., JA-17 rotor, 20 min). About 10 mg of soluble Ic–Ec or Ic–Ec(∇9) were routinely obtained from one liter of induced culture. About 30 mg of MEn–In or MEn–In(9) were routinely purified using an amylose column from one liter of induced culture. For assembling dimeric SCD protein on an amylose column, the cells containing MEn–In or MEn–In(9) from 0.5 l of induced culture were harvested and lysed by sonication in 25 ml of sonication buffer on ice. The cell debris was removed by centrifugation (12 000 r.p.m., JA-17 rotor, 20 min) and the crude cellular extracts loaded onto the column. After briefly washing with two column volumes (40 ml) of refolding buffer, 10 mg of soluble Ic–Ec or Ic–Ec(∇9) was loaded onto the column. The flow-through fractions were collected and reloaded onto the column. The column was then washed with 500 ml of refolding buffer and eluted with the same buffer containing 10 mM maltose. SCD protein-containing fractions were pooled, dialyzed against refolding buffer containing 50% glycerol and kept at −20°C until use. About 20 mg of SCD proteins are obtained routinely by the procedure described above.

[https://patents.google.com/patent/US7851192B2 https://patents.google.com/patent/US7851192B2]

read these two before making T7 Endo I using spycatcher/spytag

[https://www.ncbi.nlm.nih.gov/pubmed/16264086 https://www.ncbi.nlm.nih.gov/pubmed/16264086]

[https://patents.google.com/patent/US7851192B2/en https://patents.google.com/patent/US7851192B2/en]



SD Polymerase

&nbsp;For fragmentation, 200 ng gDNA of E.coli strain BL21(DE3) was added to the reaction 83mixture: 1X reaction buffer for SD polymerase (Bioron GmbH), 3.5 mM MgCl2, dNTPs 0.25 mM 84(each), DNase I 1.5 ng/μl, SD DNA polymerase 1.5 U/μl. The total volume of the reaction was 25 85μl. The reaction mixture was completed at 4oC (wet ice). The fragmentation of gDNA was carried 86out by two-step incubation: 20 minutes at 30oC and then 20 minutes at 70oC. For incubation we 87used thermal cycler with heated lid.The reaction was stopped by cooling down to 10oC. The 88mixture was diluted 1:1 with sterile water and fragmented DNA was purified with SPRI beads.

[https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0210374 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0210374]