Editing Ribosome Display (section)

== Ribosome Display for Nanobody&nbsp; Discovery ==

Llama VHH antibody fragments against GFAP: Better diffusion in fixed tissues than classical monoclonal antibodies 

DOI: 10.1007/s00401-009-0572-6

Antigen preparation and induction of humoral immune response in alpaca 250 ll of hGFAP (1 mg/ml) were mixed with 250 ul of Freund complete adjuvant for the first immunization, and with 250 ul of Freund incomplete adjuvant for the following immunizations (In France, an ethical approval is not required for immunization of animals with Freund (in-) complete adjuvant.). One young adult male alpaca (Lama pacos) was immunized subcutaneously at days 0, 21 and 35 with 250 ug of this antigen preparation. The alpaca was bled and the immune response was monitored by the titration of serum samples by ELISA on GFAP. 

Constitution of a VHH library 

The blood of the immunized animal was collected; the lymphocytes were isolated by centrifugation on a Ficoll (Pharmacia) discontinuous gradient and stored at -80oC until further use. Total RNA and cDNA were obtained as previously described [21]. DNA fragments encoding only the VHH domains were amplified by PCR according to Lafaye et al. [20]. The primers specific for VHH were complementary to the 50 and 30 ends of the amplified product and incorporated Sfi1 and Not1 restriction sites at the ends of the VHH genes. The PCR products were digested and ligated into phage vector pHEN 1 [19]. The VHH population was converted to ribosome-display format using PCR and transcribed to mRNA as described [24, 36] with some modifications. Briefly, clones from the VHH population were amplified using a primer 

VHH-SPEF (5'GGAGATATATATCCATGAGAGGATCGCATCACC ATCACCATCACGGATCCGCCGAKGTSCAGCTG-3') that contained a 50 extension containing the prokaryotic Shine–Dalgarno sequence and a primer 

VHH-SPER (5'CC ATATAAAGCTTTGAGGAGACGGTGACCTG-3'). The 400 bp PCR product was then amplified using a mixture of 

SDA-MRGS primer (5 uM) (5'AGACCACAACGGTTT CCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGG AGATATATCCATGAGAGGATCG-3'), SPER primer (5 uM) and T7C (5 uM) (5'-ATACGAAATTAATA CGACTCACTATAGGGAGACCACAACGGTTTCCCT C-3'). The 450 bp product was purified with the Wizard SV purification kit (Promega). A peptide linker, lacking a stop codon, was added to ensure that the protein displayed on the ribosome was accessible to potential ligands. DNA encoding this linker, corresponding to a part of the E. coli protein TolA was PCR amplified using primers VHH-link (5'-CAGGTC ACCGTCTCCTCAAAGCTTTATATGGCCTCGGGGGC C-3') and TolAkurz (5'-CCGCACACCAGTAAGGTGT GCGGTTTCAGTTGCCGCTTTCTTTCT-3'). Finally, the library was assembled with the TolA linker by PCR assembly using primers TolAkurz and T7B (5'-ATACGA AATTAATACGACTCACTATAGGGAGACCACAACG G-3'). The final assembly product corresponded to a library of VHH with all of the 5' and 3' regions necessary to its use for ribosome-display selections. Ribosome-display selection rounds Principle Ribosome-display technology enables in vitro selection of a protein together with the mRNA that encodes it. A DNA library coding for a particular proteins, for instance VHH fragments, is transcribed in vitro. The mRNA is purified and used for in vitro translation. Because the mRNA lacks a stop codon, the ribosome stalls at the end of the mRNA, giving rise to a ternary complex of mRNA, ribosome and functional protein [16]. A library of these ternary complexes is tested against the potential ligand (in the case of antibodies, against the antigen). The binding of the ternary complex (ribosome, mRNA and protein) to the ligand allows the recovery of the encoding mRNA that is linked to it and that can be transcribed into cDNA by reverse transcriptase-PCR (RT-PCR). Cycles of selection and recovery can be iterated both to enrich rare ligand-binding molecules, and to select molecules with the best affinity.

Technique Glial fibrillary acidic protein (10 ug/ml) was bound in a Maxisorp plate (Nunc) and selections by Glial fibrillary acidic protein (10 ug/ml) was bound in a Maxisorp plate (Nunc) and selections by ribosome display were performed at 4oC. Selection was performed according to Zahnd et al. [36]. The wells were blocked with 300 ll 0.5% BSA in TBS for 1 h at RT. Before the ribosome-display round, the wells were extensively washed with WBT buffer (50 mM Tris acetic acid, pH 7.5, 150 mM NaCl, 50 mm Mg(CH3COO-)2, 0.05% tween 20). A ribosome display round consisted in a 15 min pre-panning step on a well coated with PBS and a 1 h binding step on the target protein. After washing (round 1: 6 washes in WBT, 5 s each, round 2: 6 washes 5 min each and round 3: same as round 2 with 3 additional washes 30 min each), RNA purification and reverse transcription (with oligonucleotide SPER), a first PCR was done using oligonucleotides VHH-SPEF and VHHSPER. This RT-PCR product was purified on an agarose gel and re-amplified in a second PCR using T7C, SDAMRGS and SPER. This PCR product was purified on an agarose gel and re-amplified in a third PCR using T7b and TolAkurz. The third PCR product served as template for the next round of ribosome-display format. Three rounds of selection were performed to isolate high-affinity binders.

VHH was expressed either with a His-tag or with a CH2 domain, allowing its recognition by anti-tag or anti-alpaca antibodies VHH expression with a His-tag The coding sequence of the VHH was subcloned in vector pET 22 using the NcoI and NotI restriction sites allowing the expression of VHHs in frame with a His-tag at the carboxy terminal end (Novagen, Darmstadt, Germany). The expression and purification of VHH were performed according to Lafaye et al. [20]. The plasmids containing the VHH were sequenced by Genome Express using T7 promoter and T7 terminator primers. Expression of VHH with the CH2 domain Anti-His-tag antibodies may prove to be difficult to use in IHC experiments. This is why VHHs coupled with the CH2 domain were also prepared. Specific and sensitive rabbit anti-alpaca antibodies-directed against the CH2 domain are available [20]. Moreover, secondary anti-rabbit antibodies conjugated with horseradish peroxidase are routinely used in Neuropathology Laboratories. The alpaca immunoglobulin CH2 domain was amplified by RT-PCR using primer CH2-Fwd-Not and CH2-Rev-Xho [20]. These primers contain respectively a NotI and a Xho1 site allowing the cloning of CH2 domain in pET 22 vector in frame with VHH gene. The expression and purification of VHH were performed according to Lafaye et al. [20].

Determination of dissociation constants by ELISA 

We determined the binding affinity of VHHs as described elsewhere [13]. Briefly, various concentrations of GFAP were incubated in solution overnight at 4oC with a known quantity of VHH until equilibrium was reached. The VHH concentration had been determined by preliminary ELISA calibrations. One hundred microliter of solution was transferred to a well of a microtiter plate previously coated with GFAP and was incubated for 20 min at 4oC. The plates were washed with PBS–Tween 0.1%. VHHs were detected with rabbit anti-His-tag antibodies (eBiosciences, San Diego, CA) followed by the addition of b-galactosidase- conjugated goat anti-rabbit Igs (Biosys, Compie`gne, France) and 4-methylumbelliferyl b-D galactoside (Sigma Aldrich, Saint-Quentin Fallavier, France). Fluorescence was read at 460 nm, after the excitation at 355 nm. KD was estimated from the slope of the regression curve obtained by plotting the reciprocal of the fraction of bound antibody versus the reciprocal of the molar concentration of antigen.
[[Category:Antibodies]]