Editing Cleancap mRNA Invitro Transcription (section)

== Template preparation ==

1. Double-stranded DNA template

'''**NOTE: CleanCap AG requires modification to the sequence just downstream of the T7 promoter sequence, replacing the “GG” that follows the T7 promoter sequence with an “AG” as follows:'''





'''Standard T7 promoter (underlined) with&nbsp;''''''GG'''''':'''

'''5’&nbsp;TAATACGACTCACTATA''''''GG''''''&nbsp;3’'''

'''Sequence required for CleanCap<sup>®</sup>&nbsp;with AG:'''

'''5’&nbsp;TAATACGACTCACTATA''''''AG''''''&nbsp;3’'''

'''New primer'''

'''T7-mRNA-F&nbsp;'''<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">&nbsp;(for pCDNA5 plasmid) (Box&nbsp;</span>O1<span style="white-space: pre;">well </span>I3)

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">AAAT'''TAATACGACTCACTATA'''''AG''</span>

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''T7-mRNA-F2''' (for pCDNA5 pCMV5-frt plasmid)</span>

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">AT'''TAATACGACTCACTATA'''''AG''GAGACCCAAG</span>



<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''T7-mRNA-F3'''&nbsp;(for plasmid with traditional T7 promoter and kozak seq, such as pMiniT2--IRES)</span>

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''TAATACGACTCACTATA'''''AG''GAGG</span>

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''T7-mRNA-F4''' (for plasmid vector pCAGGS, </span>2724<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">)</span>

'''TAATACGACTCACTATA'''''AGGCAAGGCCACCGCCACCATG''

Reverse primer for 2724&nbsp;pCAGGS:&nbsp;pCAGGS-mRNA-R2

tTTTTTTTTTTTTTTTTTTTTTTTAAATGATTTGCCCTCC<br/>(GGAGGGCAAATCATTTAAAAAAAAAAAAAAAAAAAAAAAa)

reverse primer for C-Flag tag

'''Flag-R'''<br/>(CAAAGACGATGACGACAAGTAACTCGAGAAAAAAAAAAAAAAA)<br/>&nbsp;TTTTTTTTTTTTTTTCTCGAGTTACTTGTCGTCATCGTCTTTG





<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">2. NEB Monarch<sup>®</sup>&nbsp;RNA Cleanup Kit (500 µg),&nbsp; &nbsp;[https://www.neb.com/products/t2050-monarch-rna-cleanup-kit-500-ug https://www.neb.com/products/t2050-monarch-rna-cleanup-kit-500-ug]&nbsp;T2050&nbsp;</span>

'''For pMiniT2-pA vector&nbsp;''' pA-T7-F<br/>TAATACGACTCACTATAGGGAGAC

pA-mRNA-R<br/>TAGGTAATCGTCACCTGcag<br/>(ctgCAGGTGACGATTACCTA)

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Co-transcriptional Capping Protocol:'''<br/>('''NOTE''': <span style="color:#FF0000;">'''5 mM final each NTP'''</span> instead of 10 mM in standard HiScribe Reaction)</span>

#<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">Thaw the necessary components, keep the T7 RNA Polymerase Mix on ice.&nbsp;</span>
#<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">Mix and pulse-spin in a microfuge to collect the solutions to the bottom of the tubes.&nbsp;</span>
#<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">Set up the reaction at&nbsp;'''room temperature'''&nbsp;in the following order:</span>

{| border="1" cellspacing="0" cellpadding="0"
|-
! width="259" | 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Component'''</span>

! width="134" | 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Volume'''</span>

! width="197" | 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Concentration'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Nuclease-free Water'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''X µl'''</span>

| 


|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''10X Reaction Buffer'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''2 µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''0.5X final'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''100 mM ATP'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''2 µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''5 mM final'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''100 mM GTP'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''2 µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''5 mM final'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''100 mM pseudo-UTP'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''2 µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''5 mM final'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''100 mM 5m-CTP&nbsp;'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''2 µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''5 mM final'''</span>

|-
| Cyanine 5-UTP, optional<br/>
| 0.5 '''µl'''
| <br/>
|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''100 mM CleanCap''''''<sup>®</sup>''''''&nbsp;AG or AG (3’ OMe) (N-7113 or N-7413)'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''<span style="color:#FF0000;">1.6</span> µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''4 mM final'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Linear Template DNA'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''X µl'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''<span style="color:#FF0000;">1 µg</span> total'''</span>

|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''T7 RNA Polymerase Mix'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''<span style="color:#FF0000;">2 </span>µl'''</span>

| 


|-
| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''Total'''</span>

| 
<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'''<span style="color:#FF0000;">40</span> µl'''</span>

| 


|}

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">1.Mix thoroughly by pipet and pulse-spin in a microfuge. Incubate at 37°C for 2 hours in a dry air incubator or PCR machine to prevent evaporation.</span>

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">2. Follow the protocol provided with the HiScribe T7 High Yield RNA Synthesis Kit (NEB E2040S ) for DNase treatment and RNA purification.</span>

<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">3. Add TURBO DNase (ThermoFisher Scientific, incubated at 37 ◦C for 30 min Purify with column</span>

4, Add 5 µL of 10×Phosphatase Buffer to the reaction.&nbsp;

5, Add 1 µL of RNase-free DNase&nbsp;&nbsp;



<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">6,&nbsp; Add 2&nbsp;</span>µL&nbsp;<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">Antarctic Phosphatase (New England Biolabs) inccubate 37 ◦C for 30 min (&nbsp;Phosphatase treatment</span>&nbsp;reduces innate immune response in mammalian cells)



<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px;">'</span>''5m-CTP''''''&nbsp;''': 5-Methylcytidine-5'-Triphosphate

'''pseudo-UTP'''''':&nbsp;'''Pseudouridine-5'-Triphosphate

Cyanine 5-UTP, 100 nmol&nbsp;[https://www.perkinelmer.com/product/cyanine-5-utp-nel583001ea NEL583001EA $646.00&nbsp;]&nbsp; ,&nbsp;[https://www.enzolifesciences.com/ENZ-42506/cyanine-5-utp-enhanced/ ENZ-42506, 250 nmol, $354.00&nbsp;]&nbsp; ,&nbsp;[https://www.scbt.com/p/cyanine-5-utp sc-499469, 250 nmol $340]

Cyanine 3-UTP, 100 nmol&nbsp;[https://www.perkinelmer.com/product/cyanine-3-utp-nel582001ea NEL582001EA&nbsp; $641]&nbsp;[https://www.apexbt.com/cy3-utp.html 25ul (10mM) $195&nbsp;]&nbsp;&nbsp;[https://www.scbt.com/p/cyanine-3-utp sc-499471 250 nmol $350]