Editing Capped mRNA (section)

== Synthesis of Capped Cre Recombinase mRNA ==

===  ===

This protocol describes the synthesis of Cre recombinase mRNA from a DNA template containing the Cre gene. Briefly, generic 5′ and 3′ UTRs are ligated to the Cre open reading frame (ORF). Ligation is facilitated by the use of splint oligonucleotides that bridge the junctions between the UTRs and the ORF. To this newly synthesized product, a tract of 120 Ts is appended by PCR. The final construct is amplified and used to template in vitro transcription of mRNA.

=== Materials ===

Cre ORF PCR

pBABE-puro-Cre (kindly provided by Dr. Zhe Li, Harvard Medical School)

KAPA HiFi Hotstart ReadyMix (Harvard Biopolymers – Catalog #KK2601)

5′ ORF Oligo - 5′TCCAATTTACTGACCGTACACC3′

3′ ORF Oligo - 5′CTAATCGCCATCTTCCAGCAGG3′

ORF Forward Primer Kinase Treatment

T4 Polynucleotide Kinase (PNK) with Buffer (New England Biolabs – Catalog #M0201)

Adenosine-5′-Triphosphate (ATP) (100 mM, USB (Affymetrix) – Catalog #77241)

5′ UTR and 3′ UTR Ligation

Cre Amplicon

5′ UTR Oligo

- 5′TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG3′

3′ UTR Oligo, Phosphorylated

-5′TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG3′

5′ Splint Oligos

- 5′GGTGTACGGTCAGTAAATTGGACATGGTGGCTCTTATATTTCTT3′

3′ Splint Oligos

- 5′CCCGCAGAAGGCAGCGATTAGCGGTAGAAGGTCGT3′

Ampligase Enzyme with Buffer (Epicentre Biotechnologies – Cat. No. A32750)



PCR to add poly-T tail (Tail PCR)

KAPA HiFi Hotstart Readymix (Harvard Biopolymers – Cat. No. KK2601)

Tail Forward Primer (Generic)

- 5′TTGGACCCTCGTACAGAAGCTAATACG3′

Tail Reverse Primer (Generic) PAGE Purified

- 5′T120CTTCCTACTCAGGCTTTATTCAAAGACCA3′



In Vitro Transcription

T7 MEGAscript Kit (Ambion – Catalog #AM1334M)

Adenosine-5′-Triphosphate (ATP) (100 mM, USB (Affymetrix) – Catalog #77241, 75 mM, included in T7 MegaScript Kit)

Guanosine-5′-Triphosphate (GRP) (100 mM, USB (Affymetrix) – Catalog #77243, 75 mM, included in T7 MegaScript Kit)

Pseudouridine-5′-Triphosphate (100 mM, TriLink Biotechnologies – Catalog #N-1019)

5-Methylcytidine-5′-Triphosphate (100 mM, TriLink Biotechnologies – Catalog #N-1014)

3′-O-Me-m7G(5′)ppp(5′)G Cap Analog (New England Biolabs – Catalog #S1411)

Tail PCR Products (100 ng/μL)



RNA Purification

MEGAclear Kit (Ambion – Catalog #AM1908M)

Phosphatase Treatment

Antarctic phosphatase (New England Biolabs – Catalog #M0289)



=== Cre Recombinase ORF PCR Amplification ===

1. Perform 5′ phosphorylation of the Cre ORF Forward primer.<br/>Combine the following:<br/>300 pmol primer (3 μL of 100 μL stock)<br/>1 μL (10U) PNK enzyme<br/>5 μL 10x buffer<br/>50 nmol ATP (0.5 μL of 100 μL stock)<br/>Incubate at 37 °C for 30 minutes<br/>Heat-inactivate at 65 °C for 20 minutes<br/>Add 250 μL TE to make 1 μM stock (100 μL to make 2 μM stock)

<br/>2. Amplify the Cre Recombinase ORF by PCR amplification. Perform a Gradient PCR around the Tm of the primers.<br/>Perform 25 μL reactions by combining the following:<br/>12.5 μL 2x KAPA HiFi Hotstart ReadyMix<br/>3.75 μL Phosphorylated ORF Forward Primer (2 μM)<br/>3.75 μL ORF Reverse Primer (2 μM)<br/>Template DNA – 10–20 ng<br/>H2O to bring final volume to 25 μl<br/>Thermal cycler profile:<br/>95 °C 5 min<br/>98 °C 20 sec<br/>An external file that holds a picture, illustration, etc. Object name is nihms378773t1.jpg Object name is nihms378773t1.jpg<br/>25 cycles<br/>Gradient 15 sec<br/>72 °C 60 sec<br/>72 °C 5 min<br/>4 °C Hold<br/>Analyze on agarose gel (can use 1 μL of PCR reaction diluted 10x)

<br/>3. Perform a QIAQuick purification to purify the gel-excised DNA product (CRE recombinase). Use QIAQuick Spin Columns.<br/>Combine 5 volumes of PB Buffer to 1 volume of reaction (5:1). Mix with pipettor and apply to column. Centrifuge at 6,000 rpm for 1 minute, and discard the flow-through.<br/>Wash with 750 μL PE. Centrifuge at 6,000 rpm for 1 minute, and discard the flow-through.<br/>Centrifuge again at 6,000 rpm for 1 minute and place filter on a clean Eppendorf tube.<br/>Elute with water (nuclease-free) or EB buffer. Wait ≥ 1 minute before centrifuging at 6,000 rpm for 1 minute.

<br/>4. Quantify and quality control PCR product using Nanodrop machine.



=== UTR Ligation ===

5. Ligate the UTRs to the CRE recombinase ORF amplicon isolated above. Begin by combining the following for a 20 μL reaction:<br/>4 μL 5′ UTR (1 μM)<br/>4 μL 3′ UTR-Phosphorylated (1 μM)<br/>2 μL 5′ Splint (1 μM)<br/>2 μL 3′ Splint (1 μM)<br/>2 μL 10x Buffer<br/>1 μL Ampligase<br/>1 μL CRE ORF amplicon<br/>4 μl Water<br/><br/>6. Thermal profile for UTR Ligation:<br/>95 °C 10 sec<br/>An external file that holds a picture, illustration, etc. Object name is nihms378773t2.jpg Object name is nihms378773t2.jpg<br/>5 cycles<br/>45 °C 60 sec<br/>50 °C 60 sec<br/>55 °C 60 sec<br/>60 °C 60 sec<br/>4 °C Hold

Perform QIAQuick Purification as described above in the Cre Recombinase ORF PCR amplification protocol.

NOTE: It may be desirable to TA clone the newly generated UTR-flanked Cre amplicon into a plasmid to avoid the need to re-amplify from the Cre DNA plasmid. This can be accomplished by using the pcDNA3.3-TOPO TA Cloning Kit.

NOTE: Check and ensure the ligation worked by diagnostic PCR by using flanking primers and subsequently performing gel electrophoresis to double-check if the product is of the expected size. This is a critical juncture for troubleshooting—if the ligation is unsuccessful (it often requires multiple attempts) try either a wider/smaller gradient of temperatures or try a sequential ligation. The difficulty lies in that the two splints usually have different annealing conditions so both will not stick at once.



=== Tail PCR ===

7. This section will append 120 Ts to the above synthesized Cre ORF with newly ligated 5′UTR and 3′UTR. Begin by diluting the PCR product (Cre ORF with 5′ UTR and 3′UTR) to 10 ng/μL.

<br/>8. Perform a 25 μL PCR reaction by combining the following:<br/>12.5 μL 2x KAPA HiFi Hotstart ReadyMix<br/>1 μL Tail Forward Primer (5 μM) – final concentration is 200 nM<br/>1 μL Tail Reverse T120 Primer (5 μM) – final concentration is 200 nM<br/>PCR product (10 ng/μL) – 10–20 ng<br/>H2O to bring final volume to 25 μl

<br/>9. Thermal cycler profile for Tail PCR reaction:<br/>95 °C 5 min<br/>98 °C 20 sec<br/>An external file that holds a picture, illustration, etc. Object name is nihms378773t3.jpg Object name is nihms378773t3.jpg<br/>25x<br/>65 °C 15 sec<br/>72 °C 45 sec<br/>72 °C 10 min<br/>4 °C Hold

<br/>10. Analyze the PCR product via gel electrophoresis (can use 1 μL of PCR reaction diluted 10x).

<br/>11. Perform QIAQuick Purification as described above in the Cre Recombinase ORF PCR amplification protocol.

<br/>12. Quantify and quality control the purification product by Nanodrop and dilute to 100 ng/μL



=== In Vitro Transcription of Modified Cre RNA ===

13. This section is for the in vitro transcription of modified Cre mRNA using the above stated protocol. Begin by preparing a nucleotide triphosphate (NTP) mix. This mix recipe is sufficient for 5.4 reactions and this proportion of Cap:GTP allows for ~80% of transcripts to be capped, though this can contribute to reduced yield. The cap powder should be dissolved in 35 μL H2O. The recipe is as follows:<br/>Mix Concentration Desired Final Concentration<br/>Cap 15 mM 6 mM<br/>GTP 3.75 mM 1.5 mM<br/>ATP 18.75 mM 7.5 mM<br/>5methylCTP 18.75 mM 7.5 mM<br/>PseudoUTP 18.75 mM 7.5 mM

14. For a 2x reaction (40 μL), combine reagents in the following order in a PCR strip at room temperature. The NTP Mix and template should be thawed on ice, then moved to room temperature (but only for setting up the IVT, immediately return to ice afterward). The 10x Buffer can be pre-warmed to 37 °C. It is important to ensure there is no precipitate in the 10x Buffer. The template concentration should be pre-adjusted at 100 ng/μl.<br/>Custom NTP Mix 16 μL<br/>10x Buffer (Kit) 4 μL<br/>Template (Tail PCR) 16 μL (1.6 μg)<br/>T7 Enzyme Mix (Kit) 4 μL<br/>Total 40 μL

15. Incubate the reaction at 37 °C for up to 12 hours.

16. Perform DNase treatment with 2 μL TURBO DNase (Kit) for each reaction. Gently mix and incubate at 37 °C for 15 min.

17. Perform purification with MEGAclear Kit as described in the manufacturer’s instructions: Begin by pre-warming the 115 μL Elution Solution per reaction at 95 °C using PCR machine.

18. Bring the in vitro transcription (IVT) reaction volume to 100 μL by adding 58 μL of Elution Solution. Mix by pipetting and transfer the total volume to an RNase-free Eppendorf tube.

19. To the new RNase-free Eppendorf tube, add 350 μL Binding Solution Concentrate and mix by pipetting.

20. Add another 250 μL of 100% ethanol solution and mix by pipetting.

21. Transfer the sample to a filter cartridge (assembled on a collection tube).

22. Centrifuge for 1 min at 10,000 RPM. Take care to avoid the escape of glass fibers out of the column and into the collection tube. Discard the flow-through.

23. Wash each reaction with 500 μL Wash Solution and centrifuge for 1 min at 10,000 RPM. Discard the flow-through.

24. Repeat wash with 500 μL Wash Solution. Discard the flow-through.

25. Dry by centrifuging for 30 seconds at 10,000 RPM.

26. Place filter on a new collection tube and elute RNA by adding 50 μL of 95 °C Elution Buffer. Centrifuge for 1 min at 10,000 RPM.

27. Repeat the elution step with 50 μL of 95 °C Elution Buffer. Centrifuge for 1 minute at 10,000 RPM.

28. Quantify the RNA using a Nanodrop machine before proceeding to Antarctic phosphatase treatment and a second of purification by the MEGAclear Kit.

29. Perform Antarctic Phosphatase treatment by adding 10 μL 10x buffer to each reaction. Then add 3 μL Antarctic Phosphatase. Gently mix and incubate the reaction for 30 minutes at 37 °C. Optional: Inactivate reaction at for 5 minutes at 65 °C.

31. Perform RNA Purification with MEGAclear Kit as described above (Step 17 – 27).

32. Quantify the RNA using Nanodrop. Each 2x reaction will generally produce ~50 μg RNA (the expected yield of a 40 μL reaction is generally 40 – 60 μg).

33. Adjust the RNA concentration to 100 ng/μL using RNase-free TE buffer.

34. Aliquot RNA and store at −20 °C or −80 °C. −20 °C is preferable to reduce freeze/thaw cycles.

Note: To quality control RNA, load the RNA and run gel electrophoresis under native conditions. High quality RNA should result in the observation of a single band.

===  ===

=== Cre RNA Transfection ===

1.&nbsp; After allowing one or two days for recovery of pE4-hiPSCs from plating and single cell-dissociation, prepare to transfect with mRNA continuously for seven days.

<br/>2.&nbsp; Dilute 100 ng/μl of Cre RNA 5x in Opti-MEM basal media. Dilute 5 μl of RNAiMAX per microgram of RNA 10x in Opti-MEM. Combine these two dilutions and incubate at room temperature for 15 minutes.

<br/>3.&nbsp; Take the six-well plate(s) of pE4 hiPSCs out of the 37 °C incubator. Feed each well with 2 ml of fresh mTeSR1 media and 50 – 100 ng/ml of B18R interferon inhibitor.

<br/>4.&nbsp; After changing the media, add RNA/RNAiMAX complex directly to the media.

<br/>5.&nbsp; After 4 – 6 hours, refresh each well with 2 ml of mTeSR1 media and 50 – 100 ng/ml of B18R interferon inhibitor. All media changes should contain B18R when RNA transfection is occurring.

<br/>6.&nbsp;&nbsp; Incubate the plates in the incubator overnight. and repeat this procedure (Step 11 – 14) every day for 7 days.

<br/>7.&nbsp;&nbsp; After the seventh day of RNA transfection, allow putative Cre-excised hiPSC clones to expand into colonies. After observing colony formation, seed a 6-well gelatinized plate with CF1 MEF feeder cells.