Editing 2301 pR-wtSM2-NucA (section)

== '''Results'''  ==

=== CLONING  ===

gene synthesis 

<br> 

[[Image:2197-2273 2301pcr.JPG]]<br> 

2nd fragment<br> 

PCR sm2 gene from 1680 pCold-GST-wtSM2 using this pair of oligos 

<br> 

2301-SM2-NucA-Nde1-F GCCgac catatgacgctcgaatccatcgac<br>old oligo<br>1 ul of 10 uM WtSM2-Xho1-R<br>(gagttgatgggctgcaaaaac taa ctcgag ctagca)<br>tgctagctcgagttagtttttgcagcccatcaactc 

<br> 

[[Image:2273-2 2301-2 2302pcr.JPG]] 

join 2 fragment<br>2301-SM2-NucA-1 TAGCACAGATCTACGTGTGGCCTGGCTGTACCATGACTGACACATTCACAACATG 

<br>1 ul of 10 uM WtSM2-Xho1-R<br>(gagttgatgggctgcaaaaac taa ctcgag ctagca)<br>tgctagctcgagttagtttttgcagcccatcaactc<br>[[Image:2273 2301pcr.JPG]]<br><br> digest with BglII + Xho1<br> 

[[Image:Digest for 2197 2273 2301 2302 2312.JPG]]<br><br> 

=== Colony Screening  ===

Date: 2014_8 

cloning, grow at 30 oC to suppress expression.<br>expression, grow at 30 oC, induce at 37 ~ 42 oC.<br> 

Make miniprep, use BglII + Xho1 to find positive clone<br> 

[[Image:2197 2302 2312 2301diget.JPG]] 

[[Image:2301 2273digest.JPG]]<br> 

send 2301-2 to sequence, it is the correct clone<br> 

Transform Ecoli K12 JM101, grow at 37oc overnight, the next morning, inoculate sevral colonies into 5ml LB, grow at&nbsp; 37oC overnight.

add 20 ul culture medium to 2ug plasmids DNA, incubate 30min,run gel

[[Image:Benzonase_activity.JPG]]





<br> 

<br>