Editing 367pEC-pfu (section)

== '''Results'''<br>  ==

=== cloning  ===

&nbsp;PCR, use the following two pairs of primers and use 381 as template<br> 

&nbsp; PCR1<br> 

&nbsp; Pfu-Nde1-F1<br>&nbsp; tatgattttagatgtggattac 

&nbsp; Pfu-Kpn1-R1<br>&nbsp;(ctggcttaacattaaaaaatcc ggtac)<br>&nbsp;gtaccggattttttaatgttaagccag<br> 

&nbsp;PCR2<br> 

&nbsp; Pfu-Nde1-F2<br>&nbsp; tgattttagatgtggattac 

&nbsp; Pfu-Kpn1-R2<br>&nbsp; ctggcttaacattaaaaaatcc g<br>&nbsp; cggattttttaatgttaagccag 

PCR: 

PCR 1<br>Pfu-Nde1-F1 + Pfu-Kpn1-R1 

TATG---pfu--- GGTAC 

PCR 2<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C 

Mix two PCR reactions, denature and reannealat least 25% 

Nde1<br>TATG----pfu--- GGTAC<br>&nbsp;&nbsp; AC----pfu---- C 

[[Image:367PCRUSE381AS TEMPLATE.JPG]]<br> 

Run gel, cut out bands, put into the same tube (i.e., one tube), add DG buffer, heat at 65 oC until dissolve, purify with spin column, elute with 20 ul water.<br>Heat 95 oC for 10min, turn off PCR machine, cool slowly to room temp. 

[[Image:DIGEST FOR 367.JPG]] 

Add to purified NdeI+KpnI digested vector (at least 1:4 ratio, 1 vector + 4 Insert),ligate and transform<br> 

<br> 

=== Colony Screening  ===

Date: 2013 

DIGEST WITH NdeI+KpnI+XbaI<br> 

[[Image:367digest.JPG]]<br> send 367-1 to sequence, there are several mutations needed to fix 

<br> 

=== Fix mutations  ===

&nbsp;PCR<br> 

&nbsp; use 367-1 as template&nbsp;and use the following four pairs of primers to fix the mutations<br> 

Pfu-Nde1-F1 + Pfu-fix-R3===&gt;660bp<br> 

Pfu-fix-F3 + Pfu-fix-R1===&gt;1000bp<br> 

Pfu-fix-F1 + Pfu-fix-R2===&gt;360bp<br> 

Pfu-fix-R2 + Pfu-Kpn1-R1===&gt;300bp<br> 

use phusion HS polymerase, 24cycles 

[[Image:367fix mutations1.JPG]]<br> 

then join four fragments by PCR&nbsp;:(use 0.15ul Phusion HS polymerase and 0.1ul Q5 hot start polymerase for each PCR reaction, extention time:2min30s, 25cycles)<br> 

PCR 1<br>Pfu-Nde1-F1 + Pfu-Kpn1-R1 

TATG---pfu--- GGTAC 

PCR 2<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C 

[[Image:367fix mutations.JPG]]<br> 

Mix two PCR reactions, denature and reannealat least 25% 

Nde1 &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; Kpn1<br>TATG----pfu--- GGTAC<br> AC----pfu---- C <br> 

Run gel, cut out bands, put into the same tube (i.e., one tube), add DG buffer, heat at 65 oC until dissolve, purify with spin column, elute with 30 ul water.<br>Heat 95 oC for 10min, turn off PCR machine, cool slowly to room temp. 

Digest 1454pEC vector with Nde1+ Kpn1<br> 

[[Image:DIGEST FOR 367.JPG]] 

Add PCR products to purified NdeI+KpnI digested vector (at least 1:4 ratio, 1 vector + 4 Insert), 

ligate(5ul 10*T4 ligase buffer and 2ul T4ligase )and transform NEB TURBO<br> 

<br> 

=== Colony Screening  ===

Date: 2013 

DIGEST WITH NdeI+KpnI+XbaI<br> 

[[Image:367fix mutationsdigest.JPG]]<br> <br> <br> 

<br>