Editing Clone antibody from Hybridoma (section)

== Protocol 2 ==

based on this paper&nbsp;[http://onlinelibrary.wiley.com/doi/10.1016/S0014-5793(99)00649-3/full http://onlinelibrary.wiley.com/doi/10.1016/S0014-5793(99)00649-3/full]

2.2 Primer design

Two databases of 491 mouse heavy chain and 356 mouse light chain signal sequences, expanded from the Kabat database ([32], [http://immuno.bme.nwu.edu/ http://immuno.bme.nwu.edu/]), were used to design the PCR primers. Each signal sequence was assigned to a Vκ or a VH gene family [23,25], according to the related reference listed in the Kabat database. The signal sequences belonging to the same Ig gene family were aligned and the most conserved region was chosen to define consensus signal sequence primers as depicted on Tables 1 and 2. The antisense primer <u>RevCκSalI</u> (5′-CGACTA GTCGAC TGGTGGGAAGATGGATACAG-3′) contains the reverse complement of codons 113–120 of <u>kappa light chain </u>constant region. The following antisense oligonucleotides were designed to match the heavy chain constant regions: RevCγ1 SalI (5′-CGACAA <u style="line-height: 20.8px;"><span style="line-height: 20.8px;">GTCGAC&nbsp;</span></u>TAGCCCTTGACCAGGCATCC-3′; matching codons 141–147 of Cγ1), <u>RevCγ2a SalI (5′-CGACAA <span style="line-height: 20.8px;">GTCGAC&nbsp;</span>TAACCCTTGACCAGGCATCC-3</u>′; matching codons 141–147 of Cγ2a), RevCγ2b SalI (5′-CGACTA <span style="line-height: 20.8px;">GTCGAC&nbsp;</span>CAGGGATCCAGAGTTCCAAG-3′; matching codons 156–166 of Cγ2b) and RevCγ3 SalI (5′-CGACTA TAGCCTTTGACAAGGCATCC-3′; matching codons 141–147 of Cγ3). These primers contained a SalI restriction site (underlined) for further cloning. The 5′-CG-3′ dinucleotide found in this restriction site is extremely rare in mammalian genomes [33] and the frequency of SalI recognition sites in variable domains of mouse antibodies is approximately 0.1–0.2%

Design PCR primers based on Table 1 and Table 2.

2.3 cDNA synthesis and PCR amplification of VH and Vκ genes from mouse hybridomas

Total RNA was extracted from 2×108 hybridoma cells using the TRIzol technique (Gibco BRL, Grand Island, NY, USA) as described by the manufacturer. 50 μg of total RNA was annealed at 65°C for 5 min with 10 pM of <u>RevCκSalI primer for light chain</u> cDNA synthesis or appropriate <u>RevCγSalI primer for heavy chain </u>cDNA synthesis in a 50 μl final volume of 1×first-strand cDNA synthesis buffer (Gibco BRL) containing 10 μM dNTPs (Gibco BRL) and 1 mM DTT (Gibco BRL). After annealing, the samples were cooled for 20 min at 20°C. 400 U of reverse transcriptase Superscript II (Gibco BRL) and 40 U of RNase inhibitor (Promega, Madison, WI, USA) were then added and the reaction was incubated for 1 h at 42°C. Reverse transcriptase activity was inactivated by incubation at 95°C during 5 min and cDNA was kept at −20°C until use. PCR amplification was carried out in a final volume of 20 μl containing 1 μl of cDNA synthesis reaction, 10 μM dNTPs, 2 μl of 10×PCR buffer (New England Biolabs, Beverly, MA, USA). <u>'''Fourteen''' VH and '''18''' Vκ PCR reactions were set up using each group of family-specific 5′ primers</u> (Tables 1 and 2) and the appropriate 3′-oligonucleotide probe matching the light or heavy chain constant region. Two mixtures, containing all VH or Vκ 5′ primers, were also set up. No PCR reaction was performed with primer specific for the VH13 (3609N) gene family since the only reported member assigned to this family is the non-functional allele of PC3609 [35]. The amount of each primer used was initially 10 pM for non-degenerated oligonucleotide and was increased two- to eight-fold depending on the degeneracy. The reaction mixtures were heated to 94°C for 10 min, then 2 U Vent DNA polymerase (New England Biolabs) was added and 30 cycles of amplification were carried out for 1 min at 94°C, 1 min at 55°C and 2 min at 72°C. After a 10 min extension at 72°C, the PCR products were fractionated through a 1.5% agarose gel (Gibco) and stained with ethidium bromide. Sets of 5′ primers and 3′ primers leading to a 390 bp product for Vκ amplification and a 450 bp product for VH amplification were selected from this family-specific PCR screening. Five replicates using the same selected primers were subjected to a new PCR as described above. The PCR-amplified DNA products were gel purified on a 1.5%, low melting temperature agarose gel (Gibco).

IgG2a

'''RT primers:'''

RevCγ2a SalI for IgG2A Heavy chain&nbsp;(5′-CGACAA GTCGAC TAACCCTTGACCAGGCATCC-3′; matching codons 141–147 of Cγ2a),

<u style="line-height: 20.8px;">RevCκSalI</u><span style="line-height: 20.8px;">&nbsp;for IgG2A light chain&nbsp;(5′-CGACTA GTCGAC TGGTGGGAAGATGGATACAG-3′) &nbsp;</span>

'''PCR Primers''' <span style="line-height: 20.8px;">&nbsp;IgG2A:</span>

[http://www.protocol-online.org/forums/uploads/monthly_12_2010/msg-6759-075982100%201291964115.ipb http://www.protocol-online.org/forums/uploads/monthly_12_2010/msg-6759-075982100%201291964115.ipb]

Mouse heavy chain constant region primers

<span style="line-height: 20.8px;">5 -gga aga tct CTT GAC CAG GCA TCC TAG AGT CA-3</span><span data-cke-bookmark="1" id="cke_bm_255C" style="display: none;">&nbsp;</span</span>



Mouse Light kappa chain constant region primer&nbsp;

3' Kc: 5 -ggt gca tgc GGA TAC AGT TGG TGC AGC ATC-3

&nbsp;

Mouse kappa chain FR1 region universal degenerate primer

'''L Chain'''

<span style="line-height: 20.8px;">5'&nbsp;Mk is&nbsp;used as the 5'&nbsp;primer for the '''VL''' amplification&nbsp;</span>

<span style="line-height: 20.8px;">Sense</span>

5' Mk: 5 -gg gag ctc GAY ATT GTG MTS ACM CAR WCT &nbsp;MCA-3

Antisense&nbsp;

3' Kc: 5 -ggt gca tgc GGA TAC AGT TGG TGC AGC ATC-3

<span style="line-height: 20.8px;">2486-</span><span style="line-height: 20.8px;">TP4-mIgG2a-LC-VR-Xho1-R</span>

(GCAGATGCTGCACCAACTGTATCC ctcgag atagca &nbsp;)

tgctatctcgagGGATACAGTTGGTGCAGCATCTGC

2486-TP4-mIgG2a-LC-VR-EcoR1-F

<span style="line-height: 20.8px;">tagaca gaattc GAY ATT GTG MTS ACM CAR WCT &nbsp;MCA&nbsp;</span>



'''H Chain&nbsp;'''

<span style="line-height: 20.8px;">An equimolar mixture of 5'</span><span style="line-height: 20.8px;">&nbsp;MH1 and 5'</span><span style="line-height: 20.8px;">&nbsp;MH2 as the 5' '''VH''' primer</span>

Sense

5' MH1: 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG &nbsp;TC-3&nbsp;

5' MH2: 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG &nbsp;TCW GG-3

2485-TP4-EcoR1-F1 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG &nbsp;TC-3&nbsp;

2485-TP4-EcoR1-F2 5 -ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG &nbsp;TCW GG-3

Antisense

IgG2A: 5 -gga aga tct CTT GAC CAG GCA TCC TAG AGT &nbsp;CA-3

&nbsp;2485-TP4-Nhe1-Xho1-R

gtgcta ctcgag GCTAGC cttgaccaggcatcctagagtcac

(gtgactctaggatgcctggtcaag GCTAGC ctcgag tagcac)
[[Category:Protocols]] [[Category:Antibodies]]