Editing 367pEC-pfu (section)

=== cloning  ===

&nbsp;PCR, use the following two pairs of primers and use 381 as template<br> 

&nbsp; PCR1<br> 

&nbsp; Pfu-Nde1-F1<br>&nbsp; tatgattttagatgtggattac 

&nbsp; Pfu-Kpn1-R1<br>&nbsp;(ctggcttaacattaaaaaatcc ggtac)<br>&nbsp;gtaccggattttttaatgttaagccag<br> 

&nbsp;PCR2<br> 

&nbsp; Pfu-Nde1-F2<br>&nbsp; tgattttagatgtggattac 

&nbsp; Pfu-Kpn1-R2<br>&nbsp; ctggcttaacattaaaaaatcc g<br>&nbsp; cggattttttaatgttaagccag 

PCR: 

PCR 1<br>Pfu-Nde1-F1 + Pfu-Kpn1-R1 

TATG---pfu--- GGTAC 

PCR 2<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C 

Mix two PCR reactions, denature and reannealat least 25% 

Nde1<br>TATG----pfu--- GGTAC<br>&nbsp;&nbsp; AC----pfu---- C 

[[Image:367PCRUSE381AS TEMPLATE.JPG]]<br> 

Run gel, cut out bands, put into the same tube (i.e., one tube), add DG buffer, heat at 65 oC until dissolve, purify with spin column, elute with 20 ul water.<br>Heat 95 oC for 10min, turn off PCR machine, cool slowly to room temp. 

[[Image:DIGEST FOR 367.JPG]] 

Add to purified NdeI+KpnI digested vector (at least 1:4 ratio, 1 vector + 4 Insert),ligate and transform<br> 

<br>