Editing Cleancap mRNA Invitro Transcription (section)

== RNA capping using Vaccinia Capping Enzyme and Cap 2´-O-Methyltransferase&nbsp; ==
<div>[https://pubmed.ncbi.nlm.nih.gov/27368341/ https://pubmed.ncbi.nlm.nih.gov/27368341/]<br/></div><div>[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5753152/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5753152/]<br/></div><div><br/></div><div>Add 7 ul 32 mM SAM to 100 ul 10X&nbsp;Capping Buffer (Final SAM is 2 mM)</div><div><br/></div><div>Combine uncapped RNA and nuclease-free water in a final volume of 14.0 μl. (Refer to step 1 in the notes on use).</div><div><br/></div><div>Heat at 65°C for 5 minutes (Refer to step 2 in the notes on use).</div><div><br/></div><div>Place tube on ice for 5 minutes.</div><div><br/></div><div>Add the following components in the order specified:</div><div>Denatured uncapped RNA (from above) 14.0 μl</div><div>10X Capping Buffer with 2 mM SAM: 2.0 μl</div><div>GTP (10 mM) 1.0 μl</div><div><s>SAM (4 mM, dilute 32 mM stock to 4 mM) 1.0 μl</s></div><div>Vaccinia Capping Enzyme (10 U/μl) 1.0 μl</div><div>mRNA Cap 2´-O-Methyltransferase (50 U/μl)&nbsp; 1.0 μl</div><div>RNase Inhibitor, Murine 0.5&nbsp;μl</div><div>Total: 20.0 μl</div><div>Note: Use of RNase Inhibitor is recommended to enhance stability of RNA in the reaction. Add 0.5 μl of RNase Inhibitor (e.g., Murine RNase Inhibitor NEB #M0314) during reaction set up. Subtract the additional volume from the amount of H2O used in the reaction.</div><div><br/></div><div>Incubate at 37°C for 60 min<br/></div><div>(For RNA less than 200 nt long increase incubation time to 2 hours).</div><div><br/></div><div>&nbsp;</div><div>RNase Inhibitor, Murine M0314S40 units/μl 3,000 units $73.00</div><div><br/></div>
IVT reactions: 1 µM primers, 40 mM Tris pH 8, 5 mM DTT, 1 mM spermidine, 0.01% Triton X-100, 4 mM each of NTP in the RNA sequence, 0.2 µM T7 RNA polymerase, 20–60 mM MgCl2.

=== RNA purification using anion-exchange chromatography ===

RNA from IVT can be purified using anion exchange chromatography on a 22 × 250 mm DNAPac PA100 column (Dionex) operated at 80°C.&nbsp;[https://www.thermofisher.com/order/catalog/product/043011#/043011 https://www.thermofisher.com/order/catalog/product/043011#/043011]

The column is run in buffers containing 20 mM Tris pH 8.0 and 5 M Urea (pH adjusted to 8.0 at room temperature). RNA of different lengths is eluted with a NaCl gradient. Salt gradients can be designed according to the respective RNA lengths to be separated. Short RNAs (2–10 nt) typically elute between 50 and 200 mM NaCl while longer constructs (60–80 nt) elute at 300–400 mM NaCl. RNA containing fractions can be analyzed using urea-PAGE, pooled and precipitated&nbsp; as below. After precipitation, RNAs can be desalted using a prepacked PD-10 Desalting column (GE Healthcare) and subsequently concentrated using a speedvac device.

=== RNA precipitation ===

RNA can be precipitated with 0.3 M NaOAc pH 5.2 and 0.7 volumes of isopropanol at −20°C for at least 2 h. The reaction is then centrifuged at 9000g and −5°C for 1 h and the pellet is washed with cold 75% ethanol and centrifuged again for 30 min. The resulting pellet is air dried and resuspended in the desired buffer for further&nbsp; applications. For short RNAs (2–10 nt), precipitation can be&nbsp;carried out with 0.2 M NaCl and 3.5 volumes of EtOH (replacing the NaOAc and isopropanol) and a precipitation time of 12 h

=== RNA capping ===

Capping reactions is performed in buffer containing 50 mM Tris, pH 8, 5 mM KCl, 1 mM MgCl2, and 1 mM DTT with 20 µM RNA. 0.5 mM GTP, 0.1 mM SAM, and capping enzyme according to the previously determined substrate to enzyme ratio is added. The reaction is incubated at 37°C and prepared for analysis by Urea-PAGE by adding an equal volume of sample buffer containing 8 M Urea, 20 mM EDTA, 2 mM Tris pH 8, and Bromophenol blue and Xylene Cyanol.

For cap-1:&nbsp; cap-1 RNA, Vaccinia MTase (NEB) is added to the capping reaction

RNA promoter sequence Promoter sequence T7 promoter Φ6.5 (for start with G) CGTAATACGACTCACTATAGG T7 promoter Φ2.5 (for start with A) CGTAATACGACTCACTATTAG