Editing Muts Activity Assay (section)

== Colorimetric Assay ==

Preparation of Tested DNA Fragments The DNA fragments were prepared from synthetic oligonucleotides. The biotinylated oligonucleotide T49, BIOT-ACAGATCCACTGTGCGACGAGCTGTGCCGCACGGTGATCGCAGCCGCTG was mixed with an equimolar amount of fully complementary A49, CAGCGGCTGCGATCACCGTGCGGCACAGCTCGTCGCACAGTGGATCTGT or almost fully complementary G49 CAG CGGCTGCGATCACCGTGCGGCGCAGCTCGTCGCACAGTGGATCTGT in order to obtain fully complementary or mismatched DNA fragments, respectively.

*<span style="line-height: 20.8px;">T49&nbsp;</span>ACAGATCCACTGTGCGACGAGCTG T GCCGCACGGTGATCGCAGCCGCTG
*<span style="line-height: 20.8px;">A49&nbsp;</span>ACAGATCCACTGTGCGACGAGCTG T GCCGCACGGTGATCGCAGCCGCTG (rev comp)
*G49 ACAGATCCACTGTGCGACGAGCTG C GCCGCACGGTGATCGCAGCCGCTG (rev comp)

To prepare oligonucleotide duplexes, the mixtures of HPLC purified oligonucleotides were suspended in a buffer containing 10 mMTris–HCl (pH 8.8/25 oC), 50 mMKCl, 0.08&nbsp;%(v/v) Nonidet P40 and 5 mMMgCl2 in a final volume of 100 ul to a final concentration of 10 uM, and subjected to heating and cooling (92 oC/120 s, 65 oC/120 s, 25 oC/120 s).

The microplate wells (Pierce&nbsp;Nickel Coated Plates, (Thermoscientific, cat. no. 15442, lot #NH174556) were unblocked by washing with five 200 ul portions of washing/ binding buffer WB (1 X&nbsp;PBS buffer (Sigma, cat. no 79383, lot. BCBF0586) supplemented with 1&nbsp;% of Tween- 20 (Cat. No P7949, lot #SZ2B2070V) and 5 mM MgCl2. One ug of his-tagged MutS protein was loaded per one microplate well in 100 ug of the same buffer. After 15 min of incubation, the well was emptied, following washing with five 200 ul&nbsp;portions of WB buffer and immediate loading of the tested biotinylated DNA (10 pmol) in 100 <span style="line-height: 20.8px;">u</span>l of WB buffer. After 10 min of incubation, the excess of unbound DNA was removed by washing with five 200 <span style="line-height: 20.8px;">u</span><span style="line-height: 20.8px;">l&nbsp;</span> portions of WB buffer. DNA binding by the immobilized protein was detected with horseradish peroxidase conjugated to avidin (Extravidin, Sigma, cat. no. E2886, lot 098K4751). The well was loaded with 100 <span style="line-height: 20.8px;">u</span><span style="line-height: 20.8px;">l&nbsp;</span> of Extravidin 1000 times diluted in WB buffer and after 10 min of incubation washed with five 200 <span style="line-height: 20.8px;">u</span><span style="line-height: 20.8px;">l&nbsp;</span>&nbsp;portions of WB buffer, following immediate loading of 100 <span style="line-height: 20.8px;">u</span><span style="line-height: 20.8px;">l&nbsp;</span> of TMB (3,30,5,50- Tetramethylbenzidine) chromogenic substrate solution (Sigma, cat. no T0440, lot 051M1850). The colour reaction was developed for 15 min, and the absorbance was measured with an ELISA reader (MultiSkan FC, ThermoScientific, cat. No. #51190000) at 620 nm. All steps of the protocol were carried out at room temperature.
[[Category:Protocols]]