Editing Phage Display from Synthetic Library (section)

=== Representative Results ===

The protocol described herein has been used to isolate antibody fragments to a variety of both structurally- and functionally-related antigen domains from combinatorial phage-displayed Fab libraries in parallel. Issues related to antigen availability can be circumvented, in many cases, by in silico identification of expressible antigen domains that are suitable for antibody selection<sup>23</sup>. By coupling antigen expression to antibody selection within the same laboratory ('''Figure 1''') it becomes feasible to construct an integrated pipeline, in which antigen parameters critical to the selection can be more easily controlled. In most cases, careful determination of domain boundaries enables the expression and isolation of adequate quantities of sufficiently pure antigen from high-throughput expression in 96 or 24 well deepwell plates ('''Figure 2''') for successful use in antibody selections. During successive rounds of the selection process, eluted phage concentrations and enrichment of phage that specifically bind antigen can be monitored by either phage titration ('''Figure 3''') or with phage pools in an ELISA assay ('''Figure 4'''). A binding ratio (>2) generally indicates the presence of specific binding clones. Conversely, a low ratio (<2) can help determine the cause of a selection failure. For instance, a ratio <2 with high non-specific OD can indicate insufficient removal of non-specific clones (or sticky binders) and may warrant further optimization of the selection protocol. Nevertheless, once enrichment is detected, individual high affinity clones can then be isolated for sequencing and characterization. Clone binding can be characterized in a colorimetric immunoassay and enables the comparison of binding of the Fab-phage or Fab to immobilized antigen versus negative control protein, yielding a measure of enrichment (ratio of binding to target versus negative control protein or affinity tag protein) ('''Figure 5''').

During scaling and automation of this method, assessment of key functions of the liquid handling unit can be helpful to ensure proper and accurate operation with solutions similar to those used during actual selections. The use of absorbing chromophores in solutions can help to detect when specific channels in the fluidics (aspiration or dispensing) are either clogged or have lost seal resulting in partial volume delivery as illustrated in '''Figure 6'''. Automated wash units can also be a source of variability and can require attention. The use of known binding clones enables comparison of binding between target control protein to ensure that target binding is maintained while background binding removed ('''Figure 7''') when wash parameters such as dispensing speed, wash volumes and the number of washes are being optimized. Following the use of an automated plate washer with phage solutions, effective decontamination protocols are necessary to ensure the absence of cross-contamination from successive rounds of selections or different selection procedures and a troubleshooting/interpretation guide is provided in '''Table 3'''.

[[File:51492fig1highres.jpg|Figure 1]]<br/>'''Figure 1. Overview – High-throughput antigen production and antibody selection pipeline. '''This overview shows a step-by-step visualization of a representative antigen generation and antibody selection pipeline. The ''in silico'' identification of antigen domain boundaries enables gene synthesis, expression and selection upon domains for proteins that may be poorly characterized. Expressed antigen domains are immobilized and used to isolate pools of specific high affinity antibody clones from a combinatorial antibody library displayed on the surface of filamentous phage. Pools of antibody-phage eluted and amplified from individual antigens can then be used to monitor round-to-round enrichment of specific binding clones in ELISA-based assays comparing immobilized target versus negative control protein prior to isolation of individual binding clones for characterization. [[Please_click_here_to_view_a_larger_version_of_this_figure.|Please click here to view a larger version of this figure.]]

[[File:51492fig2highres.jpg|Figure 2]]<br/>'''Figure 2. SDS-PAGE visualization of affinity-tagged antigens. '''A representative SDS-PAGE of expressed and purified 6X-HIS-GST-tagged antigen domains (5-10 kDa domain + 26 kDa GST) originally identified by in silico analysis of antigen domain boundaries. Protein domains expressed and isolated by affinity purification are characterized by SDS-PAGE prior to selections to ensure size-based identity, adequate yields and purity to enable use in phage-antibody selections. [[Please_click_here_to_view_a_larger_version_of_this_figure.|Please click here to view a larger version of this figure.]]

[[File:51492fig3highres.jpg|Figure 3]]<br/>'''Figure 3. Visualization of phage output titres. ''' Phage output titres are determined by plating out cells infected with phage over a 10-fold dilution series on agar media supplemented with various antibiotics (tetracycline, carbenicillin and kanamycin) to determine the lowest dilution in which colonies can be observed and estimate the number of phage bound to target antigen and eluted. [[Please_click_here_to_view_a_larger_version_of_this_figure.|Please click here to view a larger version of this figure.]]

[[File:51492fig4highres.jpg|Figure 4]]<br/>'''Figure 4. Binding ratio of target to negative control protein by pooled ELISA. '''The progress of enrichment can be evaluated following rounds of selection by screening individual amplified eluents against both the specific targets and negative control proteins and/or isolated affinity tag. Shown in the plot are the enrichment ratios for binding of 96 individual phage-antibody pools against their 96 respective antigens versus negative control protein in parallel. Each ratio value is derived from two absorbance measurements that quantify binding of the phage pool to either target or negative control protein using a HRP-fused antibody specific for M13 phage coat protein. A ratio threshold of 2 or greater (often ranging from 2–10 or more as depicted in red) is used as an indication of enrichment and the likely presence of specific binding clones. Lesser ratios can signify failure of or specific issues with the selection that may warrant further optimization of the protocol. [[Please_click_here_to_view_a_larger_version_of_this_figure.|Please click here to view a larger version of this figure.]]

[[File:51492fig5highres.jpg|Figure 5]]<br/>'''Figure 5. Direct binding clonal Fab-phage or Fab ELISA.''' The binding of single clones (whether in Fab-phage or Fab format) can be evaluated by ELISA-based assay versus immobilized protein in 384 well plates. Binding is detected using a secondary HRP-fused antibody against the M13 coat protein on Fab-phage or an affinity tag on the Fab. Raw absorbance values for binding of clonal Fab-phage to target antigen, negative control protein and antigen affinity tag (GST) are depicted illustrating specific binders (A01, A04, A06), and sticky binders (A05).

[[File:51492fig6highres.jpg|Figure 6]]<br/>'''Figure 6. Evaluation of dispensed volumes by automated liquid handling unit.''' Consistent and accurate delivery of intended volumes by robotic or manual 96-well pipetting systems can be evaluated using dyed solutions and a plate reader. In this example, 10 µl of a solution containing bromophenol blue is pipetted sequentially to all wells of two 96 well plates using a single tip box. Each well contains 90 µl/well dH<sub>2</sub>O, analogous to the addition of helper phage to infected''E. coli.'' Each plate’s absorbances at 590 nm are read in triplicate, and the volumes are interpolated from a standard curve prepared using a calibrated single channel pipetman. Volumes delivered to a single row on the first and second plate are shown. Note that on the first plate, well E04 receives no dyed solution, and on the second plate, it receives a double volume. This indicates that the tip touch is not sufficient for consistent delivery, and requires further optimization. 95% confidence intervals for triplicate absorbance measurements are shown.

[[File:51492fig7highres.jpg|Figure 7]]<br/>'''Figure 7. Evaluation of automated plate washing.''' Effective removal of unbound phage can be assessed using an ELISA to measure Fab-phage binding to immobilized positive (anti-FLAG antibody) and negative (BSA) control proteins while varying the wash conditions. In this example, input phage analogous to naïve library (10<sup>13</sup> cfu/ml in PBT) is removed using eight or sixteen washes, by hand or using the robot. Residual phage binding to BSA is the same across all conditions, as is specific binding to immobilized anti-FLAG antibody, indicating that at this low flow rate, both methods are equivalent and sufficiently stringent. 95% confidence intervals from duplicate wells are shown.



{| border="1"
|-
| '''SOLUTIONS'''
|-
| 2YT media - Add water to 1 L, adjust pH to 7.0, and autoclave.
| yeast extract
| 10 g
|-
| tryptone
| 16 g
|-
| NaCl
| 5 g
|-
| NZY media (1 L)
| N-Z Amine
| 10 g
|-
| yeast extract
| 5 g
|-
| 50X ZYM-5052
| 20 ml
|-
| 20 salt stock
| 50 ml
|-
| 50x ZYM-5052 sugar stock (1 L)
| glucose
| 25 g
|-
| lactose
| 100 g
|-
| glycerol
| 250 ml
|-
| 20x salt stock (1 L)
| Na<sub>2</sub>HPO<sub>4</sub>
| 500 mM
|-
| KH<sub>2</sub>PO<sub>4</sub>
| 500 mM
|-
| NH<sub>4</sub>Cl
| 1 M
|-
| Na<sub>2</sub>SO<sub>4</sub>
| 100 mM
|-
| Carbenicillin (Carb):
| 100 mg/ml in water. Filter-sterilize.
|-
| Kanamycin (Kan):
| 25 mg/ml in water. Filter-sterilize.
|-
| Tetracycline (Tet):
| 10 mg/ml in water. Filter sterilize.
|-
| PEG-NaCl
| PEG
| 20%
|-
| NaCl
| 2.5 M
|-
| 1x PBS (pH7.2)
| NaCl
| 137 mM
|-
| KCl
| 3 mM
|-
| Na<sub>2</sub>HPO<sub>4</sub>
| 8 mM
|-
| KH<sub>2</sub>PO<sub>4</sub>
| 1.5 mM
|-
| 1X KCM
| KCl
| 500 mM
|-
| CaCl<sub>2</sub>
| 150 mM
|-
| MgCl<sub>2</sub>
| 250 mM
|-
| SOC Media
| yeast extract
| 5 g/L
|-
| tryptone
| 20 g/L
|-
| NaCl
| 10 mM
|-
| KCl
| 2.5 mM
|-
| MgSO<sub>4</sub>
| 20 mM
|-
| Glucose
| 20 mM
|-
| Blocking buffer
| PBS
| 1x
|-
| BSA
| 0.20%
|-
| PBT buffer
| PBS
| 1x
|-
| BSA
| 0.20%
|-
| Tween
| 0.05%
|-
| PT buffer
| PBS
| 1x
|-
| Tween
| 0.05%
|-
| Phosphoric acid
| H<sub>3</sub>P0<sub>4</sub>
| 1 M
|}

'''Table 1. Media and Solutions.'''



{| border="1"
|-
| '''PCR MASTER-MIX SET-UP'''
|-
| '''Component'''
| '''µl per reaction'''
|-
| Water
| 19.45
|-
| 10x Taq buffer
| 2.5
|-
| dNTPs (10 mM stock)
| 0.675
|-
| DMSO
| 0.75
|-
| Taq enzyme
| 0.125
|-
| Forward Primer (100 uM stock)
| 0.25
|-
| Reverse primer (100 uM stock)
| 0.25
|-
| '''Heavy Chain Sequencing Primers'''
|-
| M13 Forward primer
| GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC
|-
| M13 Reverse primer
| CAGGAAACAGCTATGACGGGAAGTGTCCTTGACCA
|-
| '''Light Chain Sequencing Primers'''
|-
| M13 Forward primer
| TGTAAAACGACGGCCAGTCTGTCATAAAGTTGTCACGG
|-
| M13 Reverse primer
| CAGGAAACAGCTATGACCCCTTGGTACCCTGTCCG
|-
| PCR SETTINGS
|-
| Step 1.
| 94 °C for 3:00 min
|-
| Step 2.
| 94 °C for 0:30 min
|-
| Step 3.
| 55 °C for 0:30 min
|-
| Step 4.
| 72 °C for 1:00 min
|-
| Return to Step 2 and repeat 24x
| jump to step 2
|-
| Step 5.
| 72 °C for 7:00 min
|-
| Step 6.
| 12 °C hold
|}

'''Table 2. PCR Master Mix and Settings.'''



{| border="1"
|-
| '''Interpretation of decontamination results'''
|-
| '''Plate'''
| '''Expected carbenicillin titer'''
| '''If not?'''
|-
| Pre-infection control
| 0
| Cells were pre-infected; nothing can be concluded from the experiment.
|-
| Contamination control
| lawn
| Insufficient contamination to be able to assess efficacy of subsequent decontamination; consider submerging manifold in phage solution rather than aspirating it.
|-
| Decontamination test
| 0
| Decontamination not complete; increase soak time, bleach concentration or try SDS and EtOH washes instead.
|}

'''Table 3. Evaluation of washer decontamination.''' To determine the efficacy of decontamination, it is necessary to show that washer was contaminated with phage, and that the decontamination protocol successfully eliminated that contamination. Using phage that confer carbenicillin resistance, the expected outcomes from such a test are listed, along with suggestions should the real outcome differ from the expected outcome.

Subscription Required. Please recommend JoVE to your librarian.