Editing 1030-pHis-GST-TEV

Cloning of pHis-GST-TEV (1030)<br>Purpose: to clone pHis-GST-TEV<br>Date: 2012-3-26 to 2012-4-11<br>Notebook: Xiaojing Wang<br>Page: 004206<br>Clone ID: 1030<br>Experimenters: Xiaojing Wang<br>Results <br> 

[[Image:1030 PCR 3.27.2012.JPG]]<br> 

The bands show PCR product of 1030,<br> 

TEV-Nde1-F<br> atcatg CATATG GGAGAAAGCTTGTTTAAGGG<br> 

TEV-Xho1-R <br> (cagttaaggaagcgactcaatag ctcgag actgac) 

gtcagtctcgagctattgagtcgcttccttaactg 

<br> 

Digest result: <br> 

[[Image:1030 P V digest 3.28.2012.JPG]]<br> 

digest PCR product and vector with Nde1+Xho1, run gel 

the left bands show 1030 insert, the right bands show 1029 vector 

gel purify, ligate, transform Top10,K+ 

Colony Screening <br> 

[[Image:1030 digest 3.30.2012.JPG]]<br> 

1032-1,-2,-3,-4 may be correct. 

Select 1032-4 to sequence.<br> 

<br> 

Wrong design<br>should not use TEV-Nde1-F<br> 

Results <br> 

[[Image:1030 2 PCR 4.2.2012.JPG]]<br> 

The bands show PCR product of 1030, 

Use primer:<br>TEV-EcoR1-F<br>TATCG GAA TTC GGA GAA AGC TTG TTT AAG G<br> E F G E S L F K <br>TEV-Xho1-R <br> Xho1<br>(cagttaaggaagcgactcaatag ctcgag actgac) 

gtcagtctcgagctattgagtcgcttccttaactg 

<br> 

Digest result: <br> 

[[Image:1030 pv digest 4.5.2012.JPG]]<br> 

digest PCR product and vector with EcoR1+Xho1, run gel 

the left bands show 1030 insert, the right bands show 1029 vector 

gel purify, ligate, transform Top10,K+ 

Colony Screening <br> 

Select 10 clones to do PCR Screening<br> 

[[Image:1030 PCR Screening 4.6.2012.JPG]]<br> 

Clone 2,3,4,5,6,7,8,10 may be correct.<br> 

Select Clone 2,3,4,5 to mini-prep.<br> 

Miniprep digestion 4/7/2012 

[[Image:1030 EcoR1 Xho1 4 7 2012.jpg]] 

Digest 1030 plasmid with Nco1 + EcoR1 + Xho1, why there is only 1 insert band? 

[[Image:203 549 4 8 2012.jpg]] 

[[Image:Phi29 gene synthesis 4 8 2012.jpg]] 

<br> 

4/9/2012<br> 

digest 1030 miniprep , #2 and #3 (above) with Xho1, EcoR, Nco1<br> 

[[Image:1030 4 9 2012 digestion 1.jpg]]<br> 

[[Image:1030 4 9 2012 digestion 2.jpg]]<br> 

{| cellspacing="1" cellpadding="1" border="1" style="width: 372px; height: 133px;"
|-
| Lane #<br> 
| 1<br> 
| 2<br> 
| 3<br> 
| 4<br> 
| 5<br> 
| 6<br> 
| 7<br>
|-
| Sample #<br> 
| 3<br> 
| 3<br> 
| 3<br> 
| 4<br> 
| 4<br> 
| 4<br> 
| pET28b vector<br>
|-
| Digestion 
| Xho1-EcoR1<br> 
| Nco1-Xho1<br> 
| Nco1-EcoR1<br> 
| Xho1-EcoR1<br> 
| Nco1-Xho1<br> 
| Nco1-EcoR1<br> 
| Nco1-Xho1<br>
|-
| Insert<br> 
| TEV<br> 
| GST-TEV<br> 
| GST<br> 
| TEV<br> 
| GST-TEV<br> 
| GST<br> 
| x<br>
|}

<br> 

sequencing: #3 with T7 term: good<br> 

4/17/2012 Expression in Nico21(DE3) cells: 

[[Image:GST-TEV 4 17 2012.jpg]] 



[[Image:GST-TEV_4_17_2012_2.jpg]]

1, 2, 5, 6, 7, 8, 9: after Ni and Glutathione beads

3, 4, 10,11, 12, 13,14, 15: After Ni beads

[[Category:Cloning]]