Editing 1250 pET28b-KOD-2

== '''Cloning of 1250 pET28b-KOD-2'''  ==

'''Purpose:''' Cloning of 1250 pET28b-KOD-2 

'''Date: '''July 6, 2012<br> 

'''Notebook:&nbsp;''' 

'''Page:''' 

'''Clone ID: '''1250 

'''Experimenters: '''Jennifer Truong 

== '''Results'''  ==

=== Cloning  ===

Date:&nbsp;July 7, 2012<br> 

Digest 480 pET28b-KOD with EcoR1 + Not1, see lane 5 

Cut out and purify fragment 

[[Image:0706 digestion.JPG]]<br>PCR this ~120bp fragment out from 480 pET28b-KOD using primer<br>KOD-EcoR1-F TTGAGA GAATTC TGAGAGCCTTC<br>KOD-Not1-R GGATCCGCGGCCGCGGTACCAGTTCCCTTCGGCTTCAGCCAAG<br>[[Image:1250 amp.JPG]]<br> 

Expected size ~120 bp, cut out band, elude with 50 uL&nbsp;water<br> 

Digest with EcoR1 + Not1<br>clone back into 480 pET28b-KOD <br> 

[[Image:0707 digestion.JPG]]<br> 

Digested pET28b-KOD (lane 6)&nbsp;and digested PCRed pET28b-KOD (lane 5), saved vector from lane 6, but need to rePCR the digested pET28b-KOD<br> Date:&nbsp;June 9, 2012<br> 

[[Image:0709 pcr.JPG]] 

Expected size ~120 bp (see lane 4), cut out band, purify<br> 

Digest with EcoR1 + Not1<br>clone back into 480 pET28b-KOD <br> 

[[Image:1250_digestion.JPG]]<br>

Digest DNA (lane 1) and vector 480 (lane 2) with EcoR1 + Not1<br>Clone back into 480 pET28b-KOD <br>

Cut out bands in lanes 1 and 2, purify together and ligate

Transform with Top10 and plate on Kan plate, grow overnight

=== Colony Screening<br>  ===

Date:&nbsp;July 10, 2012

[[Image:1250_Screening.JPG]]

Only samples 5 and 6 had positive inserts

== '''Result intepretation/Summary'''<br>  ==

== '''Conclusion'''<br>  ==

[[Category:Cloning]]