Editing 164 pT7A3-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H

<pre>PCR fragment 1 from 2369 pT7A3-lc-MBP-(TEV)
2094-T
CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATAT
    TTTATTAAAACAAATTGAAATTCTTCCTCTATATAGTAC

MBP-seq-R (CGGTTCTTGCAGGTTGAAC)
gttcaacctgcaagaaccg

PCR fragment 2 from 2369 pT7A3-lc-MBP-(TEV)

pET-seq-F2  ATCTCGACGCTCTCCCTTATG
2094-B
CATGATATATCTCCTTCTTAAAGTTAAACAAAATTATTT

Purify on gel, PCR again 
pET-seq-F2  ATCTCGACGCTCTCCCTTATG
MBP-seq-R (CGGTTCTTGCAGGTTGAAC)
gttcaacctgcaagaaccg

Digest with BsaI + SphI
clone into  BsaI + SphI 162 pCold-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H</pre>

[[File:164 PCR Cloning.JPG|RTENOTITLE]]



[[File:164 digestion.JPG|RTENOTITLE]]

sequencing data: no T7A3 promoter. It is pCold promoter.. So it is clone # 162.&nbsp;





[[File:163 165 v digestion.JPG|RTENOTITLE]][[File:164 digestion.JPG|RTENOTITLE]]



[[File:164 pJet digestion.JPG|RTENOTITLE]][[File:162 160 164 pJet digestion.JPG|RTENOTITLE]]

[[File:163 164 PCR Screening.JPG|RTENOTITLE]]http://www.excellgen.net/eln/images/2/2c/163_164_digestion.JPG



[[File:164 163 XbaI Xho1.JPG|RTENOTITLE]][[File:164 163 Nhe1 Xho1.JPG|RTENOTITLE]]

[[File:164 163 Xba Xho1 2.JPG|RTENOTITLE]]

== Redo ==

above methods were not working. use this method:
<pre>subcloning from 162 pCold-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H 
to 163 pT7A3-MBP-(Tev)-GST-(3C)-sfGFP
using Nco1+ Xho1</pre>

insert: 162

Vector: 163-2, #3

enzymes: NcoI+ Xho1

[[File:162 163 digestion2.JPG|RTENOTITLE]]

miniprep digestion

1/4/19

[[File:164 digestion 1 4 19.JPG|RTENOTITLE]][[File:164 digestion2 1 4 19.JPG|RTENOTITLE]][[File:164 digestion3 1 4 19.JPG|RTENOTITLE]][[File:164 digestion4 1 4 19.JPG|RTENOTITLE]][[File:164 digestion5 1 4 19.JPG|RTENOTITLE]][[File:164 digestion6 1 4 19.JPG|RTENOTITLE]]



== Expression ==

1/9/19

Transform Nico21(DE3)pLysN, grow on LB/KC at 37 oC O/N, Wash coloines with LB/KC medium and make glycerol stock.

Grow cells in 15 ml 2XYT, induce with 1 mM IPTG or 0.1% L-arabinose when OD600 reaches ~0.8.

For 162, cool culture on ice for 10 min, Add 1 mM IPTG and induce for 2 hours or overnight, keep culture cool using blue ice pad.

Induce either at -18 oC (blue ice pad) for 162, or room temperature for 164, 169, 170, for 2 hours or overnight

Spin down cells, wash with ddH2O, Add lysis buffer and store at -80 oC freezer o/n

Lyse cells by freeze-thaw 3 time. Add 2 ul DNase.

Spin, transfer supernatant to another clean tube (as soluble fraction).

To pellet, add buffer with 0.1% SDS, 4 M Urea, 50% Buffer A.

Add 25 ul Ni beads

Binding by rotary for 30 min

Spin and remove supernatant, wash 3~5 times buffer A

Add 25 ul&nbsp; Buffer B. Spin, collect 25 ul euluate.

Add 8 ul 4X SDS-PAGE Loading buffer, Boil 10 min.

Run 4~20% SDS-PAGE

&nbsp;pI/Mw: 8.69 / 123.9

{| border="1" cellspacing="1" cellpadding="1" style="width:500px;"
|-
| Well #
| Clone ID&nbsp;
| Name<br/>
| Induction time, condition<br/>
| Smaple<br/>
| Expression
|-
| M
| <br/>
| PageRuler Plus
| <br/>
| <br/>
| <br/>
|-
| 1
| 162
| pCold-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H<br/>
| 2 h, 16 oC
| sup
| <br/>
|-
| 2
| 162
| <br/>
| 2 h, 16 oC<br/>
| pellet
| y, IB
|-
| 3
| 162
| <br/>
| o/n, 16~23 oC<br/>
| sup<br/>
| <br/>
|-
| 4
| 162
| <br/>
| o/n, 16~23 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| 5
| 164
| pT7A3-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H<br/>
| 2 h, 37 oC<br/>
| sup<br/>
| <br/>
|-
| 6
| 164
| <br/>
| 2 h, 37 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| 7
| 164<br/>
| <br/>
| o/n, 25 oC<br/>
| sup<br/>
| <br/>
|-
| 8
| 164<br/>
| <br/>
| o/n, 25 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| 9
| 169
| pBad-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H<br/>
| 2 h, 37 oC<br/>
| sup<br/>
| <br/>
|-
| 10
| 169
| <br/>
| 2 h, 37 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| 11
| 169
| <br/>
| o/n, 25 oC<br/>
| sup<br/>
| <br/>
|-
| 12
| 169
| <br/>
| o/n, 25 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| 13
| 170
| pT7-MBP-(tev)-GST-(3c)-Tat-NLS-iFLP-6H<br/>
| 2 h, 37 oC<br/>
| sup<br/>
| <br/>
|-
| 14
| 170
| <br/>
| 2 h, 37 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| 15
| 170
| <br/>
| o/n, 25 oC<br/>
| sup<br/>
| <br/>
|-
| 16
| 170
| <br/>
| o/n, 25 oC<br/>
| pellet<br/>
| y, IB<br/>
|-
| MB
| <br/>
| Biorad protein marker
| <br/>
| <br/>
| <br/>
|}



Conclusion: Tat-Flp in pCold,&nbsp; induction for 2 hours,&nbsp; is the best for expression. But still not soluble.

[[File:162 164 169 170 expression.JPG|RTENOTITLE]]
[[Category:Cloning]]