Editing 326 pAd5-CMV-Dest-HA

'''The primer-Rs of 326 and 326' &nbsp;are different.'''

<br> '''1. Cloning of pAd5-CMV-Dest-HA (326)''' 

'''Purpose:''' to clone pAd5-CMV-Dest-HA by PCR 

'''Date:''' 2011-11-28 to 2011-12- 

'''Notebook:''' Xiaojing Wang 

'''Page: '''004127---004131 

'''Clone ID:''' 326 

'''Experimenters:''' Xiaojing Wang 

'''Results''' 

[[Image:327 326 373 PCR 11.29.2011.JPG]]<br> The middle bands show PCR product of 326, 

Primer: 

ad-GW-F<br> Kpn1<br>aactc GGTACC ATCAACAAGTTTGTACAAAAAAG 

ad-GW-R Xho1<br>(TCTTGTACAAAGTGGTTGATtacccatacgatgttccagattacgcttgaCTCGAGatcga)<br>tcgatCTCGAGtcaagcgtaatctggaacatcgtatgggtaATCAACCACTTTGTACAAGA<br> 

Digest result: 

[[Image:327 326 373 PCR digest 11.29.2011 S.JPG|153x269px|327 326 373 PCR digest 11.29.2011 S.JPG]][[Image:327 326 373 vector digest 11.29.2011.JPG|356x270px|327 326 373 vector digest 11.29.2011.JPG]] 

<br> 

digest PCR product and vector with Kpn I+Xho I,run gel 

the left picture shows 326 insert, the right picture shows 326 vector (pAd5-CMV-MCS, 280)&nbsp; 

gel purify, ligate, transform ccdb survival,AMP 

<br> 

Colony Screening 

[[Image:326 373 plasmid digest 12.1.2011.JPG]]<br> 

Select 5 clones to mini-prep, digestd by Kpn I and Xho I. 326-1,-3,-4,-5 may be correct. Control is 326-1.<br> 

pDonr221_EGFP(393) + pAd5-CMV-Dest-HA(326-1) make gateway by LR Clonase II. 

Transform 393+326-1 by STBL3, Amp. 

Select 4 clones to mini-prep(i.e.326+393 1-4 plasmids), then transfect 293T cell line. 

48 hours after transfection, take pictures. <br> 

[[Image:326+393 gateway 12.8.2011.jpg]]<br> 

<br> 

326+393 1-4 plasmids are digested by BamHI. Control is 326+393-4. 

[[Image:326+393 digest 12.5.2011.JPG|377x479px|326+393 digest 12.5.2011.JPG]]<br> 

326+393 -1, -2 and -4 may be correct.<br> 

<br> <br> 

'''2. Cloning of pAd5-CMV-Dest-HA (326')'''<br>Purpose: to clone pAd5-CMV-Dest-HA by PCR<br>Date: 2011-12-16 to 2012-1-3<br>Notebook: Xiaojing Wang<br>Page: 004127---004131<br>Clone ID: 326'<br>Experimenters: Xiaojing Wang<br>Results 

Primer: 

ad-GW-F<br> Kpn1<br>aactc GGTACC ATCAACAAGTTTGTACAAAAAAG 

ad-GW-HA-R2<br> Nhe1 Xho1 <br>(cttTCTTGTACAAAGTGGTTGATtacccatacgatgttccagattacgcttga gct ag CTCGAG atcga) <br>tcgatCTCGAGctagctcaagcgtaatctggaacatcgtatgggtaATCAACCACTTTGTACAAGAaag 

[[Image:327 326' 373' pcr 12.16.2011 s.jpg]] 

<br> 

Digest result: 

[[Image:455 327 326' 373' 252 PCR digest 12.20.2011 s.JPG]] 

[[Image:252 327 326' 373' 455 vector digest 12.20.2011' s.JPG]] 

Ligation, Transformation<br>Select 5 clones to mini-prep<br>326' plasmids are digested by Kpn1 + Xho1, 326'-1,-2,-4,-5 plasmids may be correct.<br> 

[[Image:326' 373' digest 12.23.2011 s.JPG]] 

pDonr221_EGFP(393) + pAd5-CMV-Dest-HA(326'-1) make gateway by LR Clonase II.<br>Transform 393+326'-1 by STBL3, Amp.<br>Select 4 clones to mini-prep(i.e.326'+393 1-4 plasmids), then transfect 293T cell line.<br>48 hours after transfection, take pictures. <br> 

[[Image:326'+393 1.3.2012.jpg]] 

393+326' 1-4 plasmids are digested by BamHI. 

[[Image:326'+393 373'+393 digest bamh1 1.3.2012.JPG ]]<br> 

326'+393 -2, -3 and -4 may be correct.<br> 

<br> 

[[Category:Cloning]]