Editing 367pfu-pET30b

gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp 

Purpose: gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp. 

Date: 2011-8-15 

Notebook: Haiyan 

Page:003023 

Clone ID: 253 

Experimenters: Haiyan<br>Results <br> 

[[Image:367pfu +pET30b-9-15-2011.JPG|203x191px|367pfu +pET30b-9-15-2011.JPG]] 

<br> 

Purpose: . 

Date: 2011-10-18-- 

Notebook: Yingying Lu<br> 

Page: 

Clone ID:367<br> 

Experimenters: Yingying Lu<br>Results <br> 

[[Image:367PCR product10-18-2011.JPG]]<br> 

band 1,2,3 show PCR 1<br> 

381 plasmid as template<br> 

Pfu-Nde1-F1 + Pfu-Kpn1-R1 

TATG---pfu--- GGTAC 

band 4,5,6 PCR 2<br> 

381 plasmid as template<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C 

Run gel, cut out bands, put into the same tube (i.e., one tube), add QG buffer, heat at 65 oC until dissolve<br>purify with spin column, elute with 20 ul water.<br>Heat 95 oC for 5min, turn off PCR machine, cool slowly to room temp.<br> 

[[Image:367-PET30b-digest with Kpn10-17-2011.JPG]] 

first digest with Kpn1 ,fast digest enzyme for 45 min 

[[Image:367-PET30b-digest with Nde1 10-18-2011.JPG]] 

second digest with Nde1, NEB enzyme for 2 hours 

[[Image:367-digest detect10-21-2011.JPG]]<br> 

10 different clonies digest detect: Kpn1+Nde1<br> 

<br> 

Date: 2011-11-18-- 

Notebook: Yingying Lu 

Page: 

Clone ID:367 

Experimenters: Yingying Lu<br>Results <br> 

[[Image:367PCR 11-18-2011.JPG]]<br> 

band&nbsp; show PCR 1 

381 plasmid as template 

Pfu-Nde1-F1 + Pfu-Kpn1-R1 

TATG---pfu--- GGTAC 

band&nbsp; PCR 2 

381 plasmid as template<br>Pfu-Nde1-F2 + Pfu-Kpn1-R2<br>AC----pfu---- C 

Run gel, cut out bands, put into the same tube (i.e., one tube), add QG buffer, heat at 65 oC until dissolve<br>purify with spin column, elute with 20 ul water.<br> 

Heat 95 oC for 5min, turn off PCR machine, cool slowly to room temp.<br> 

[[Image:367 digest-vector11-18-2011.JPG]]<br> 

band show digest vector<br> 

Nde1+Kpn1 

[[Image:367+474 digest detect11-23-2011.JPG]] 

<br><br> 

<br> 

== '''Cloning of 367pfu-pET30b'''  ==

'''Purpose:''' Cloning of367pfu-pET30b by PCR<br> 

'''Date: '''2012-1-17-- 

'''Notebook:''' 

'''Page:''' 

'''Clone ID:367''' 

'''Experimenters:''' yingying 

== '''Results'''<br>  ==

[[Image:367+529_PCR_1-18-2012.JPG]]<br>

&nbsp;cold fusion cloning method<br>

template: 381-pSpeedET-Pfu <br>pfu-Nde1-F3 5 CTTTAAGAAGGAGATATA CATATG atgattttagatgtggattac 3<br>pfu-Kpn1-R3 GGCCTTGTCGTCGTCGTCGGTACC ggattttttaatgttaagccag <br>



Subcloning 

Date:&nbsp;2012- 

<br> 

<br> 

<br> 

<br> 

=== Colony Screening  ===

Date: 2012-<br> 

Make miniprep and digest with <br> 

<br> 

<br>

== '''Result intepretation/Summary'''  ==

*<br>

== '''Conclusion'''  ==

<br> 

===  ===

<br> 

[[Category:Cloning]]